Mutagenetix > Incidental Mutation

Incidental Mutation 'R9189:Ahnak'

697655

Institutional Source

Beutler Lab

Gene Symbol

Ahnak

Ensembl Gene

ENSMUSG00000069833

Gene Name

AHNAK nucleoprotein (desmoyokin)

Synonyms

1110004P15Rik, 2310047C17Rik, DY6

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R9189 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8989284-9076919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9010883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 3177 (V3177E)

Ref Sequence

ENSEMBL: ENSMUSP00000090633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092955

SMART Domains

Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092956
AA Change: V3177E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: V3177E

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART
internal_repeat_2	163	1515	5.22e-182	PROSPERO
internal_repeat_1	224	2314	N/A	PROSPERO
internal_repeat_2	1532	3028	5.22e-182	PROSPERO
internal_repeat_1	2660	5095	N/A	PROSPERO
low complexity region	5336	5353	N/A	INTRINSIC
low complexity region	5493	5504	N/A	INTRINSIC
low complexity region	5580	5600	N/A	INTRINSIC
low complexity region	5620	5636	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox1	T	A	11: 116,174,405	D608V	probably damaging	Het
Actg1	A	T	11: 120,348,187	C26S	unknown	Het
Akap11	G	A	14: 78,513,498	T483I		Het
Akr1cl	A	G	1: 65,024,671	S120P	probably benign	Het
Ankle2	G	A	5: 110,252,744	V649M	possibly damaging	Het
Ankrd55	A	T	13: 112,368,036	I439F	probably damaging	Het
Asb8	A	G	15: 98,142,754	M9T	possibly damaging	Het
Ascc1	A	T	10: 60,007,823	Y69F	probably benign	Het
Atp9a	A	T	2: 168,676,140		probably null	Het
Cd8b1	T	C	6: 71,329,768	F160L	probably benign	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Cep250	A	G	2: 155,976,430	T842A	probably benign	Het
Cgnl1	T	A	9: 71,723,565	K552*	probably null	Het
Cntnap4	C	T	8: 112,875,968	T1227M	possibly damaging	Het
Cobll1	C	A	2: 65,150,989	V86F	probably damaging	Het
Dchs2	A	G	3: 83,348,254	N2419S	probably damaging	Het
Dhx30	A	T	9: 110,085,426	L1001*	probably null	Het
Diaph1	C	T	18: 37,891,109	V559M	unknown	Het
Dis3l	A	T	9: 64,310,449	H783Q	probably benign	Het
Dock7	T	G	4: 98,989,113	T1063P	unknown	Het
Dsc1	T	C	18: 20,099,157	T265A	possibly damaging	Het
Eif2ak4	A	T	2: 118,427,912	Q581L	probably damaging	Het
Eprs	A	T	1: 185,374,137	D183V	possibly damaging	Het
Fads2	G	C	19: 10,091,819	D80E	probably benign	Het
Fam167b	G	A	4: 129,577,082	R158C	probably damaging	Het
Fam71a	G	A	1: 191,162,703	T581I	possibly damaging	Het
Flnb	T	A	14: 7,892,976	I682K	possibly damaging	Het
Gpatch2l	C	T	12: 86,244,378	P112S	probably benign	Het
Gpn1	T	A	5: 31,497,366	H87Q	unknown	Het
Greb1l	T	C	18: 10,499,983	V350A	probably benign	Het
Grm5	A	T	7: 88,074,816	K771N	probably damaging	Het
Gucy2c	C	T	6: 136,751,047	S319N	probably benign	Het
Hcfc2	G	T	10: 82,699,207	A22S	probably benign	Het
Hist1h2bg	A	G	13: 23,571,587	D52G	probably damaging	Het
Hnf4a	A	G	2: 163,551,577	D39G	probably benign	Het
Il6st	C	T	13: 112,498,806	T584M	probably damaging	Het
Irf3	T	A	7: 45,000,822	V254E	possibly damaging	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Kank4	T	A	4: 98,780,052	K53*	probably null	Het
Kcnj11	A	T	7: 46,098,752	F382L	possibly damaging	Het
Kcnq3	T	C	15: 65,995,661	Y711C	probably damaging	Het
Kctd3	A	G	1: 188,972,439	S712P	possibly damaging	Het
Krt20	A	G	11: 99,432,261	I245T	possibly damaging	Het
Larp1b	T	C	3: 40,970,604	I219T	probably damaging	Het
Lman2l	A	G	1: 36,439,690	F114L	probably damaging	Het
Loxl2	T	A	14: 69,692,410	Y746N	possibly damaging	Het
Lrrc43	T	C	5: 123,508,046	S628P	probably benign	Het
Mroh8	A	C	2: 157,269,625	D136E	probably damaging	Het
Nek8	T	A	11: 78,172,516	M141L	probably benign	Het
Nr2e1	C	A	10: 42,578,272	R22L	probably damaging	Het
Nr6a1	C	T	2: 38,926,117		probably null	Het
Olfr1164	A	G	2: 88,093,850	F29L	probably damaging	Het
Olfr1167	T	C	2: 88,149,564	M152V	probably benign	Het
Olfr1377	T	A	11: 50,985,339	C213S	probably damaging	Het
Olfr3	T	A	2: 36,812,202	M297L	possibly damaging	Het
Onecut2	A	G	18: 64,340,819	Y147C	probably damaging	Het
Pcdhac2	T	C	18: 37,144,263	F99L	probably benign	Het
Pcdhga2	T	G	18: 37,669,742	V213G	possibly damaging	Het
Pgap1	A	T	1: 54,480,749	V909E	probably benign	Het
Pik3r4	A	T	9: 105,669,839	T939S	probably benign	Het
Pip4k2c	T	C	10: 127,199,377	D374G	possibly damaging	Het
Plxdc1	A	T	11: 97,953,962	D252E	probably benign	Het
Pm20d1	A	C	1: 131,802,377	D218A	probably damaging	Het
Polq	C	A	16: 37,044,903	Q706K	probably damaging	Het
Pram1	A	T	17: 33,641,157	I233F	probably benign	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
Prss41	A	T	17: 23,842,387	H143Q	probably damaging	Het
Ptpn21	A	G	12: 98,689,002	Y569H	probably damaging	Het
Rad17	T	C	13: 100,637,056	K142E	probably damaging	Het
Rcan3	T	C	4: 135,425,296	E38G	probably benign	Het
Rgl3	C	A	9: 21,974,060	R658L	possibly damaging	Het
Rnf125	T	A	18: 20,983,183	*141K	probably null	Het
Ros1	G	T	10: 52,143,406	N711K	probably damaging	Het
Rsph10b	T	A	5: 143,959,686	Y421N	probably benign	Het
Ryr1	C	T	7: 29,077,046	V2222I	probably damaging	Het
Samsn1	C	T	16: 75,859,561	C333Y	probably damaging	Het
Slc9a2	G	A	1: 40,755,784	E502K	probably benign	Het
Stard9	A	T	2: 120,703,019	E3252D	possibly damaging	Het
Syne1	C	A	10: 5,173,008	R309S	probably damaging	Het
Syne1	T	C	10: 5,222,289	I5051V	probably benign	Het
Syngap1	A	G	17: 26,964,974	S1241G	probably damaging	Het
Tbpl2	T	C	2: 24,076,018	K321R	probably damaging	Het
Tnrc18	C	T	5: 142,731,352	G2449E	probably damaging	Het
Trim25	A	G	11: 89,010,905	D342G	probably benign	Het
Tssk4	T	A	14: 55,650,447	H33Q	probably benign	Het
Ttc3	G	A	16: 94,467,972	G1971D	possibly damaging	Het
Tufm	C	T	7: 126,489,677	Q347*	probably null	Het
Ubxn10	G	A	4: 138,720,822	S181F	possibly damaging	Het
Ushbp1	T	C	8: 71,388,895	E430G	probably benign	Het
Vmn1r33	T	C	6: 66,611,732	I279M	possibly damaging	Het
Vmn2r115	T	C	17: 23,345,810	F224L	probably damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vps13a	T	C	19: 16,686,597	I1481V	probably benign	Het
Vps35	T	C	8: 85,281,269	N294S	possibly damaging	Het
Washc3	A	T	10: 88,216,054	T102S	probably benign	Het
Zfp27	T	A	7: 29,895,934	E202V	possibly damaging	Het
Zfp58	T	C	13: 67,491,916	H152R	possibly damaging	Het
Zfr2	T	C	10: 81,244,662	V390A	probably damaging	Het

Other mutations in Ahnak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Ahnak	APN	19	9007223	missense	probably damaging	0.99
IGL00509:Ahnak	APN	19	9009951	missense	possibly damaging	0.94
IGL00539:Ahnak	APN	19	9007908	missense	possibly damaging	0.50
IGL00558:Ahnak	APN	19	9004307	missense	possibly damaging	0.93
IGL00567:Ahnak	APN	19	9013383	missense	probably benign	0.24
IGL00706:Ahnak	APN	19	9013730	nonsense	probably null
IGL00807:Ahnak	APN	19	9008522	missense	possibly damaging	0.92
IGL00870:Ahnak	APN	19	9013698	missense	probably damaging	1.00
IGL01101:Ahnak	APN	19	9012887	intron	probably benign
IGL01118:Ahnak	APN	19	9012578	missense	probably damaging	1.00
IGL01288:Ahnak	APN	19	9002494	missense	possibly damaging	0.94
IGL01324:Ahnak	APN	19	9003032	missense	probably damaging	1.00
IGL01341:Ahnak	APN	19	9011703	missense	probably benign
IGL01541:Ahnak	APN	19	9007879	missense	possibly damaging	0.95
IGL01580:Ahnak	APN	19	9002839	missense	probably benign	0.02
IGL01595:Ahnak	APN	19	9003501	nonsense	probably null
IGL01746:Ahnak	APN	19	9004912	missense	possibly damaging	0.89
IGL01766:Ahnak	APN	19	9000118	missense	unknown
IGL01821:Ahnak	APN	19	9012118	missense	probably benign
IGL01913:Ahnak	APN	19	9006064	nonsense	probably null
IGL01934:Ahnak	APN	19	9002657	missense	probably damaging	1.00
IGL01940:Ahnak	APN	19	9006557	missense	probably benign	0.14
IGL01958:Ahnak	APN	19	9014909	missense	possibly damaging	0.59
IGL02145:Ahnak	APN	19	9002855	missense	probably benign	0.11
IGL02246:Ahnak	APN	19	9008268	missense	probably damaging	1.00
IGL02282:Ahnak	APN	19	9005987	missense	probably damaging	1.00
IGL02428:Ahnak	APN	19	9014833	missense	possibly damaging	0.83
IGL02442:Ahnak	APN	19	9004016	missense	probably damaging	1.00
IGL02474:Ahnak	APN	19	9004933	missense	probably benign	0.13
IGL02483:Ahnak	APN	19	9003308	missense	probably benign	0.01
IGL02616:Ahnak	APN	19	9005627	missense	probably benign	0.03
IGL02630:Ahnak	APN	19	9012077	missense	probably damaging	1.00
IGL02690:Ahnak	APN	19	9012584	nonsense	probably null
IGL02717:Ahnak	APN	19	9002387	missense	probably benign	0.00
IGL02721:Ahnak	APN	19	9009707	missense	probably benign	0.07
IGL02737:Ahnak	APN	19	9004593	missense	probably benign	0.17
IGL02850:Ahnak	APN	19	9002596	missense	probably benign	0.00
IGL03071:Ahnak	APN	19	9011918	missense	possibly damaging	0.63
IGL03072:Ahnak	APN	19	9006508	missense	probably benign	0.11
IGL03094:Ahnak	APN	19	9003547	missense	possibly damaging	0.64
IGL03140:Ahnak	APN	19	9005212	intron	probably benign
IGL03176:Ahnak	APN	19	9008166	missense	possibly damaging	0.56
IGL03176:Ahnak	APN	19	9002449	missense	probably damaging	1.00
IGL03189:Ahnak	APN	19	9011239	missense	possibly damaging	0.65
IGL03357:Ahnak	APN	19	9009325	intron	probably benign
IGL03371:Ahnak	APN	19	9004228	missense	possibly damaging	0.91
Eskimo	UTSW	19	9009574	missense	probably benign	0.31
Nanook	UTSW	19	9003231	missense	probably benign	0.42
Netsilik	UTSW	19	9002321	missense	probably benign	0.00
IGL03097:Ahnak	UTSW	19	9002387	missense	probably benign	0.00
PIT4403001:Ahnak	UTSW	19	9006176	missense	possibly damaging	0.87
R0054:Ahnak	UTSW	19	9012056	missense	probably damaging	1.00
R0094:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R0110:Ahnak	UTSW	19	9018232	nonsense	probably null
R0141:Ahnak	UTSW	19	9006680	missense	probably damaging	1.00
R0166:Ahnak	UTSW	19	9005725	missense	probably damaging	1.00
R0309:Ahnak	UTSW	19	9002495	missense	probably damaging	1.00
R0368:Ahnak	UTSW	19	9008350	nonsense	probably null
R0386:Ahnak	UTSW	19	9011144	missense	possibly damaging	0.94
R0401:Ahnak	UTSW	19	9015116	missense	probably benign	0.24
R0415:Ahnak	UTSW	19	9012871	intron	probably benign
R0463:Ahnak	UTSW	19	9009407	intron	probably benign
R0469:Ahnak	UTSW	19	9018232	nonsense	probably null
R0470:Ahnak	UTSW	19	9008967	missense	probably benign	0.29
R0487:Ahnak	UTSW	19	9007151	missense	probably benign	0.00
R0487:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R0499:Ahnak	UTSW	19	9000264	splice site	probably benign
R0506:Ahnak	UTSW	19	9009128	missense	probably damaging	1.00
R0510:Ahnak	UTSW	19	9018232	nonsense	probably null
R0557:Ahnak	UTSW	19	9001944	missense	probably benign	0.10
R0570:Ahnak	UTSW	19	9013698	missense	probably damaging	1.00
R0610:Ahnak	UTSW	19	9007878	missense	probably benign	0.08
R0646:Ahnak	UTSW	19	9013402	nonsense	probably null
R0659:Ahnak	UTSW	19	9015002	missense	possibly damaging	0.60
R0791:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0792:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0840:Ahnak	UTSW	19	9005063	missense	probably damaging	1.00
R0847:Ahnak	UTSW	19	9006433	nonsense	probably null
R0941:Ahnak	UTSW	19	9009914	missense	probably damaging	1.00
R0962:Ahnak	UTSW	19	9012848	intron	probably benign
R1017:Ahnak	UTSW	19	9010543	missense	probably damaging	0.99
R1037:Ahnak	UTSW	19	9007618	missense	probably benign	0.27
R1085:Ahnak	UTSW	19	9013125	missense	possibly damaging	0.50
R1113:Ahnak	UTSW	19	9005620	missense	probably benign	0.29
R1140:Ahnak	UTSW	19	9004245	missense	probably damaging	1.00
R1158:Ahnak	UTSW	19	9013926	missense	probably benign	0.00
R1218:Ahnak	UTSW	19	9015619	missense	probably damaging	1.00
R1225:Ahnak	UTSW	19	9002883	missense	probably damaging	1.00
R1245:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R1421:Ahnak	UTSW	19	9015631	missense	possibly damaging	0.95
R1447:Ahnak	UTSW	19	9007082	missense	probably damaging	0.98
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1471:Ahnak	UTSW	19	9012932	intron	probably benign
R1507:Ahnak	UTSW	19	9010077	missense	probably damaging	1.00
R1521:Ahnak	UTSW	19	9004728	missense	probably benign	0.11
R1568:Ahnak	UTSW	19	9002375	missense	probably damaging	0.98
R1569:Ahnak	UTSW	19	9004094	missense	possibly damaging	0.78
R1616:Ahnak	UTSW	19	9008987	missense	possibly damaging	0.94
R1638:Ahnak	UTSW	19	9009449	missense	probably benign	0.01
R1680:Ahnak	UTSW	19	9009963	missense	probably benign	0.05
R1713:Ahnak	UTSW	19	9011809	missense	possibly damaging	0.95
R1722:Ahnak	UTSW	19	9010655	missense	probably damaging	0.99
R1771:Ahnak	UTSW	19	9013753	missense	probably benign	0.24
R1795:Ahnak	UTSW	19	9002438	missense	possibly damaging	0.79
R1823:Ahnak	UTSW	19	9004905	missense	probably damaging	0.99
R1842:Ahnak	UTSW	19	9005867	missense	probably damaging	0.99
R1854:Ahnak	UTSW	19	9013832	missense	possibly damaging	0.61
R1856:Ahnak	UTSW	19	9002048	missense	possibly damaging	0.86
R1886:Ahnak	UTSW	19	9015979	missense	probably damaging	0.98
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1912:Ahnak	UTSW	19	9017881	missense	probably damaging	1.00
R1913:Ahnak	UTSW	19	9007922	missense	probably damaging	0.99
R1942:Ahnak	UTSW	19	9015083	missense	probably damaging	0.98
R1987:Ahnak	UTSW	19	9015251	missense	probably damaging	1.00
R2006:Ahnak	UTSW	19	9007075	missense	probably damaging	1.00
R2013:Ahnak	UTSW	19	9014573	missense	probably damaging	0.98
R2014:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R2047:Ahnak	UTSW	19	9014300	missense	possibly damaging	0.67
R2048:Ahnak	UTSW	19	9007056	missense	probably damaging	0.99
R2060:Ahnak	UTSW	19	9008041	missense	probably benign	0.08
R2083:Ahnak	UTSW	19	9011557	missense	probably damaging	1.00
R2157:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R2167:Ahnak	UTSW	19	9011494	nonsense	probably null
R2208:Ahnak	UTSW	19	9017732	missense	probably benign	0.00
R2224:Ahnak	UTSW	19	9012991	intron	probably benign
R2268:Ahnak	UTSW	19	9010574	missense	possibly damaging	0.66
R2420:Ahnak	UTSW	19	9009256	missense	possibly damaging	0.89
R2426:Ahnak	UTSW	19	9002851	missense	possibly damaging	0.81
R2910:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2911:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2981:Ahnak	UTSW	19	9000148	missense	probably damaging	0.97
R3151:Ahnak	UTSW	19	9009944	missense	probably benign	0.12
R3155:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R3422:Ahnak	UTSW	19	9005708	missense	probably benign	0.39
R3422:Ahnak	UTSW	19	9006752	missense	probably benign	0.05
R3430:Ahnak	UTSW	19	9006958	missense	probably benign	0.42
R3433:Ahnak	UTSW	19	9009994	missense	probably benign	0.01
R3711:Ahnak	UTSW	19	9007898	missense	probably benign
R3723:Ahnak	UTSW	19	9016853	missense	possibly damaging	0.79
R3775:Ahnak	UTSW	19	9009023	missense	possibly damaging	0.91
R3858:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3859:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3922:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3924:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3926:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R4026:Ahnak	UTSW	19	9011299	missense	probably damaging	0.97
R4051:Ahnak	UTSW	19	9014327	missense	probably damaging	1.00
R4209:Ahnak	UTSW	19	9002600	missense	probably damaging	1.00
R4234:Ahnak	UTSW	19	9000786	nonsense	probably null
R4237:Ahnak	UTSW	19	9001783	missense	probably benign	0.02
R4285:Ahnak	UTSW	19	9016839	nonsense	probably null
R4331:Ahnak	UTSW	19	9015820	missense	probably damaging	1.00
R4342:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R4430:Ahnak	UTSW	19	9003040	missense	probably benign	0.00
R4554:Ahnak	UTSW	19	9014930	missense	probably damaging	1.00
R4602:Ahnak	UTSW	19	9010825	missense	possibly damaging	0.66
R4612:Ahnak	UTSW	19	9003724	missense	probably benign	0.44
R4655:Ahnak	UTSW	19	9008701	missense	probably damaging	1.00
R4656:Ahnak	UTSW	19	9004855	missense	possibly damaging	0.80
R4700:Ahnak	UTSW	19	9004681	missense	probably benign	0.02
R4704:Ahnak	UTSW	19	9012258	intron	probably benign
R4704:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R4705:Ahnak	UTSW	19	9016906	missense	probably benign	0.07
R4707:Ahnak	UTSW	19	9016735	missense	probably benign	0.03
R4732:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4733:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4778:Ahnak	UTSW	19	9011975	missense	possibly damaging	0.79
R4782:Ahnak	UTSW	19	9012499	intron	probably benign
R4832:Ahnak	UTSW	19	9012460	intron	probably benign
R4882:Ahnak	UTSW	19	9005897	missense	probably damaging	0.98
R4884:Ahnak	UTSW	19	9012754	intron	probably benign
R4895:Ahnak	UTSW	19	9017441	missense	probably benign	0.43
R4930:Ahnak	UTSW	19	9010967	missense	possibly damaging	0.79
R4951:Ahnak	UTSW	19	9017835	missense	probably damaging	1.00
R4968:Ahnak	UTSW	19	9015100	missense	probably damaging	1.00
R5026:Ahnak	UTSW	19	9010631	missense	possibly damaging	0.46
R5050:Ahnak	UTSW	19	9012458	intron	probably benign
R5073:Ahnak	UTSW	19	9003231	missense	probably benign	0.42
R5110:Ahnak	UTSW	19	9014759	missense	probably damaging	1.00
R5119:Ahnak	UTSW	19	9013644	missense	probably benign	0.00
R5128:Ahnak	UTSW	19	9017087	missense	probably damaging	1.00
R5139:Ahnak	UTSW	19	9004655	missense	probably damaging	1.00
R5150:Ahnak	UTSW	19	9010904	missense	possibly damaging	0.46
R5151:Ahnak	UTSW	19	9017569	missense	probably benign	0.03
R5165:Ahnak	UTSW	19	9015665	missense	possibly damaging	0.95
R5236:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R5361:Ahnak	UTSW	19	9015341	missense	possibly damaging	0.92
R5366:Ahnak	UTSW	19	9016735	missense	possibly damaging	0.65
R5387:Ahnak	UTSW	19	9003691	missense	probably damaging	1.00
R5396:Ahnak	UTSW	19	9007175	missense	probably damaging	0.99
R5583:Ahnak	UTSW	19	9006917	missense	probably damaging	0.99
R5587:Ahnak	UTSW	19	9009476	missense	possibly damaging	0.88
R5620:Ahnak	UTSW	19	9013094	nonsense	probably null
R5643:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5644:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5657:Ahnak	UTSW	19	9014615	missense	probably damaging	0.99
R5688:Ahnak	UTSW	19	9002519	missense	probably benign	0.01
R5702:Ahnak	UTSW	19	9001840	missense	probably damaging	1.00
R5727:Ahnak	UTSW	19	9016747	missense	probably damaging	0.99
R5730:Ahnak	UTSW	19	9010253	missense	possibly damaging	0.81
R5755:Ahnak	UTSW	19	9001732	missense	probably benign	0.06
R5760:Ahnak	UTSW	19	9013562	missense	probably damaging	1.00
R5789:Ahnak	UTSW	19	9002321	missense	probably benign	0.00
R5790:Ahnak	UTSW	19	9015248	missense	probably damaging	0.99
R5795:Ahnak	UTSW	19	9012382	nonsense	probably null
R5808:Ahnak	UTSW	19	9010235	missense	possibly damaging	0.91
R5867:Ahnak	UTSW	19	9010052	missense	probably damaging	0.99
R5878:Ahnak	UTSW	19	9008342	missense	probably damaging	1.00
R5898:Ahnak	UTSW	19	9013767	missense	possibly damaging	0.63
R5898:Ahnak	UTSW	19	9018211	missense	probably damaging	1.00
R5912:Ahnak	UTSW	19	9011903	missense	probably damaging	0.99
R5935:Ahnak	UTSW	19	9015182	missense	possibly damaging	0.91
R5969:Ahnak	UTSW	19	9016585	missense	probably damaging	1.00
R5988:Ahnak	UTSW	19	9009347	intron	probably benign
R6000:Ahnak	UTSW	19	9013111	nonsense	probably null
R6005:Ahnak	UTSW	19	9015161	missense	possibly damaging	0.61
R6101:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6105:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6116:Ahnak	UTSW	19	9012963	intron	probably benign
R6209:Ahnak	UTSW	19	9012566	missense	probably damaging	1.00
R6240:Ahnak	UTSW	19	9013583	missense	probably damaging	1.00
R6255:Ahnak	UTSW	19	9008025	missense	possibly damaging	0.95
R6263:Ahnak	UTSW	19	9018277	missense	probably benign	0.03
R6287:Ahnak	UTSW	19	9015003	missense	probably benign	0.02
R6296:Ahnak	UTSW	19	9003305	missense	probably damaging	0.99
R6315:Ahnak	UTSW	19	9006626	missense	probably damaging	0.99
R6328:Ahnak	UTSW	19	9007148	missense	probably benign	0.11
R6331:Ahnak	UTSW	19	9006625	missense	probably benign	0.18
R6355:Ahnak	UTSW	19	9008762	missense	probably benign	0.02
R6409:Ahnak	UTSW	19	9009574	missense	probably benign	0.31
R6567:Ahnak	UTSW	19	9008806	missense	probably benign	0.27
R6572:Ahnak	UTSW	19	9007976	missense	probably damaging	0.99
R6574:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R6590:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6620:Ahnak	UTSW	19	9015310	missense	possibly damaging	0.95
R6690:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6731:Ahnak	UTSW	19	9011562	missense	possibly damaging	0.85
R6756:Ahnak	UTSW	19	9007561	missense	possibly damaging	0.59
R6846:Ahnak	UTSW	19	9011857	missense	possibly damaging	0.66
R6854:Ahnak	UTSW	19	9015235	missense	probably damaging	1.00
R6857:Ahnak	UTSW	19	9037168	nonsense	probably null
R6863:Ahnak	UTSW	19	9012365	intron	probably benign
R6876:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R6958:Ahnak	UTSW	19	9015215	missense	possibly damaging	0.88
R7126:Ahnak	UTSW	19	9002359	missense	possibly damaging	0.61
R7181:Ahnak	UTSW	19	9013488	missense	probably damaging	1.00
R7183:Ahnak	UTSW	19	9017668	missense	probably damaging	1.00
R7202:Ahnak	UTSW	19	9017799	missense	probably damaging	1.00
R7235:Ahnak	UTSW	19	9012488	missense	unknown
R7241:Ahnak	UTSW	19	9009031	missense	possibly damaging	0.65
R7269:Ahnak	UTSW	19	9006617	missense	probably damaging	1.00
R7311:Ahnak	UTSW	19	9002143	missense	probably benign	0.04
R7311:Ahnak	UTSW	19	9009827	missense	possibly damaging	0.56
R7329:Ahnak	UTSW	19	9001792	missense	probably damaging	0.99
R7339:Ahnak	UTSW	19	9008165	missense	possibly damaging	0.75
R7390:Ahnak	UTSW	19	9003205	missense	probably benign	0.02
R7400:Ahnak	UTSW	19	9014613	missense	probably damaging	0.99
R7444:Ahnak	UTSW	19	9007423	missense	probably benign	0.08
R7483:Ahnak	UTSW	19	9004822	missense	probably damaging	1.00
R7498:Ahnak	UTSW	19	9012019	missense	probably benign	0.14
R7521:Ahnak	UTSW	19	9002351	missense	possibly damaging	0.89
R7522:Ahnak	UTSW	19	9002322	missense	probably benign	0.01
R7552:Ahnak	UTSW	19	9006824	missense	probably benign	0.18
R7563:Ahnak	UTSW	19	9011165	missense	probably damaging	0.99
R7565:Ahnak	UTSW	19	9016156	missense	probably benign	0.05
R7571:Ahnak	UTSW	19	9000786	nonsense	probably null
R7583:Ahnak	UTSW	19	9006093	missense	possibly damaging	0.90
R7600:Ahnak	UTSW	19	9004574	missense	possibly damaging	0.89
R7771:Ahnak	UTSW	19	9015047	missense	probably damaging	0.99
R7787:Ahnak	UTSW	19	9009315	missense	unknown
R7827:Ahnak	UTSW	19	9005344	nonsense	probably null
R7857:Ahnak	UTSW	19	9007468	missense	probably damaging	0.97
R7916:Ahnak	UTSW	19	9005832	missense	possibly damaging	0.66
R7939:Ahnak	UTSW	19	9014084	nonsense	probably null
R7959:Ahnak	UTSW	19	9010649	missense	possibly damaging	0.46
R7962:Ahnak	UTSW	19	9012800	missense	unknown
R7979:Ahnak	UTSW	19	9011432	missense	probably damaging	1.00
R8006:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R8013:Ahnak	UTSW	19	9009335	missense	unknown
R8033:Ahnak	UTSW	19	9003710	missense	probably benign	0.10
R8124:Ahnak	UTSW	19	9007123	missense	probably damaging	0.99
R8125:Ahnak	UTSW	19	9011876	missense	possibly damaging	0.95
R8129:Ahnak	UTSW	19	9000100	start codon destroyed	not run
R8151:Ahnak	UTSW	19	9004679	missense	possibly damaging	0.59
R8190:Ahnak	UTSW	19	9002255	missense	probably benign	0.01
R8221:Ahnak	UTSW	19	9010436	nonsense	probably null
R8241:Ahnak	UTSW	19	9007295	missense	probably benign	0.15
R8244:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8248:Ahnak	UTSW	19	9001946	missense	probably damaging	1.00
R8261:Ahnak	UTSW	19	9005453	missense	probably damaging	1.00
R8330:Ahnak	UTSW	19	9009662	missense	possibly damaging	0.86
R8380:Ahnak	UTSW	19	9017855	missense	probably benign	0.05
R8407:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8409:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8463:Ahnak	UTSW	19	9008749	missense	probably benign	0.07
R8511:Ahnak	UTSW	19	9012355	missense	unknown
R8528:Ahnak	UTSW	19	9007728	missense	probably damaging	1.00
R8549:Ahnak	UTSW	19	9011483	missense	probably damaging	1.00
R8674:Ahnak	UTSW	19	9005996	missense	probably damaging	0.98
R8716:Ahnak	UTSW	19	9009074	missense	probably damaging	1.00
R8722:Ahnak	UTSW	19	9013346	nonsense	probably null
R8751:Ahnak	UTSW	19	9010145	missense	probably damaging	1.00
R8752:Ahnak	UTSW	19	9015537	missense	probably damaging	1.00
R8783:Ahnak	UTSW	19	9011473	missense	probably damaging	1.00
R8844:Ahnak	UTSW	19	9006890	missense	probably damaging	1.00
R8859:Ahnak	UTSW	19	9007203	missense	probably damaging	1.00
R8882:Ahnak	UTSW	19	9000742	missense	probably damaging	1.00
R8907:Ahnak	UTSW	19	9009088	missense	probably benign	0.24
R8938:Ahnak	UTSW	19	9011735	missense	probably benign	0.00
R8975:Ahnak	UTSW	19	9012737	missense	probably damaging	1.00
R8983:Ahnak	UTSW	19	9004113	missense	possibly damaging	0.75
R9017:Ahnak	UTSW	19	9010123	missense	probably damaging	1.00
R9027:Ahnak	UTSW	19	9007253	missense	possibly damaging	0.94
R9081:Ahnak	UTSW	19	9008526	missense	possibly damaging	0.81
R9104:Ahnak	UTSW	19	9010347	missense	probably benign	0.01
R9112:Ahnak	UTSW	19	9009785	missense	probably damaging	0.98
R9145:Ahnak	UTSW	19	9014923	missense	probably benign	0.38
R9221:Ahnak	UTSW	19	9012579	missense	probably damaging	1.00
R9261:Ahnak	UTSW	19	9016139	missense	possibly damaging	0.63
R9299:Ahnak	UTSW	19	9012460	intron	probably benign
R9325:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R9337:Ahnak	UTSW	19	9012460	intron	probably benign
R9340:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R9351:Ahnak	UTSW	19	9007868	missense	probably damaging	1.00
R9416:Ahnak	UTSW	19	9012902	missense	unknown
R9462:Ahnak	UTSW	19	9003935	missense	probably damaging	0.96
R9469:Ahnak	UTSW	19	9010861	missense	probably damaging	1.00
R9485:Ahnak	UTSW	19	9002074	missense	probably benign	0.16
R9503:Ahnak	UTSW	19	9010094	missense	probably damaging	1.00
R9524:Ahnak	UTSW	19	9037253	missense
R9534:Ahnak	UTSW	19	9003612	missense	probably benign	0.20
R9598:Ahnak	UTSW	19	9003785	missense	probably benign	0.42
R9611:Ahnak	UTSW	19	9011798	missense	probably damaging	0.99
R9624:Ahnak	UTSW	19	9012482	missense	unknown
R9649:Ahnak	UTSW	19	9008422	nonsense	probably null
R9683:Ahnak	UTSW	19	9007355	missense	possibly damaging	0.94
R9691:Ahnak	UTSW	19	9011726	missense	possibly damaging	0.49
R9712:Ahnak	UTSW	19	9007028	small deletion	probably benign
R9712:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9713:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9715:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9725:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R9725:Ahnak	UTSW	19	9014243	missense	probably damaging	1.00
R9747:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R9798:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
RF007:Ahnak	UTSW	19	9013601	missense	possibly damaging	0.45
X0021:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
X0027:Ahnak	UTSW	19	9012037	missense	probably damaging	1.00
Z1088:Ahnak	UTSW	19	9016082	missense	probably damaging	0.99
Z1176:Ahnak	UTSW	19	9008856	missense	probably damaging	0.97
Z1177:Ahnak	UTSW	19	9017468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTCCAGAAGTTGAAGTCC -3'
(R):5'- CATTCTACATTGAGTTCTGGGC -3'

Sequencing Primer
(F):5'- TCCAAGGTAAAGTGAAAGGATCC -3'
(R):5'- GGGCCCTCAATATTCATACTGGGAC -3'

Posted On

2022-02-07