Incidental Mutation 'R9190:Bbs12'
ID 697666
Institutional Source Beutler Lab
Gene Symbol Bbs12
Ensembl Gene ENSMUSG00000051444
Gene Name Bardet-Biedl syndrome 12
Synonyms LOC241950, LOC386537, LOC241950
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9190 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 37366703-37375602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 37375223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 557 (R557L)
Ref Sequence ENSEMBL: ENSMUSP00000103756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057975] [ENSMUST00000108121]
AlphaFold Q5SUD9
Predicted Effect probably damaging
Transcript: ENSMUST00000057975
AA Change: R672L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052179
Gene: ENSMUSG00000051444
AA Change: R672L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 22 153 5.6e-8 PFAM
Pfam:Cpn60_TCP1 299 568 4.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108121
AA Change: R557L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103756
Gene: ENSMUSG00000051444
AA Change: R557L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 181 576 3.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that is involved in membrane trafficking. The encoded protein is a molecular chaperone that aids in protein folding upon ATP hydrolysis. This protein also plays a role in adipocyte differentiation. Defects in this gene are a cause of Bardet-Biedl syndrome type 12. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit enhanced adipogenesis, late onset obesity, increased susceptibility to diet-induced obesity, increased insulin sensitivity, increased glucose usage, and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,642,880 (GRCm39) T183I possibly damaging Het
Abca13 T A 11: 9,241,886 (GRCm39) S1250T probably damaging Het
Adamts12 T A 15: 11,336,446 (GRCm39) S1510R probably benign Het
Adcy5 T A 16: 35,089,364 (GRCm39) C520* probably null Het
Arhgap21 A T 2: 20,858,983 (GRCm39) M1237K probably null Het
Atp8b4 T A 2: 126,225,607 (GRCm39) N541I probably damaging Het
Bcl7c T C 7: 127,266,200 (GRCm39) T183A probably benign Het
Brd7 A G 8: 89,081,274 (GRCm39) S192P probably damaging Het
Calhm3 G A 19: 47,146,121 (GRCm39) A28V probably benign Het
Ccdc113 A G 8: 96,263,101 (GRCm39) N37S probably damaging Het
Cdh5 T G 8: 104,867,337 (GRCm39) V538G probably damaging Het
Cfap43 T C 19: 47,726,293 (GRCm39) E1639G possibly damaging Het
Clca3a2 C T 3: 144,796,599 (GRCm39) V203I probably benign Het
Clstn2 A G 9: 97,414,815 (GRCm39) F360L probably damaging Het
Cnst GTGACACGCTTG GTG 1: 179,407,039 (GRCm39) probably benign Het
Cog2 T C 8: 125,260,058 (GRCm39) Y234H probably damaging Het
Ddhd2 T C 8: 26,244,495 (GRCm39) S44G probably benign Het
Dync2i2 G T 2: 29,922,211 (GRCm39) H417N probably benign Het
Farp1 A G 14: 121,492,988 (GRCm39) E530G probably damaging Het
Fhad1 C T 4: 141,646,058 (GRCm39) probably null Het
Foxj3 T A 4: 119,477,538 (GRCm39) C449* probably null Het
Fsbp G C 4: 11,584,005 (GRCm39) V235L probably benign Het
Fuom T C 7: 139,681,252 (GRCm39) E73G probably benign Het
Gm5134 A G 10: 75,844,645 (GRCm39) H667R probably damaging Het
Igsf21 A G 4: 139,756,028 (GRCm39) I361T probably damaging Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Kmt2d A T 15: 98,749,896 (GRCm39) V2599E unknown Het
Lama1 T A 17: 68,111,514 (GRCm39) M2255K Het
Litafd C A 16: 8,501,647 (GRCm39) P50T Het
Lrrc32 A G 7: 98,148,234 (GRCm39) H338R probably benign Het
Map1b C A 13: 99,571,914 (GRCm39) R269L probably damaging Het
Ms4a5 T A 19: 11,256,733 (GRCm39) I55F probably damaging Het
Muc5b G C 7: 141,411,939 (GRCm39) L1628F unknown Het
Myo6 A G 9: 80,195,384 (GRCm39) Q918R unknown Het
Or1e25 T A 11: 73,493,877 (GRCm39) M157K probably benign Het
Or2t48 A G 11: 58,420,161 (GRCm39) V217A possibly damaging Het
Or5m11b T A 2: 85,805,884 (GRCm39) I99N possibly damaging Het
Or9i1b T G 19: 13,896,967 (GRCm39) N194K probably benign Het
Pals2 A G 6: 50,157,219 (GRCm39) R296G probably damaging Het
Plin5 A G 17: 56,419,462 (GRCm39) V320A probably damaging Het
Ptx4 A T 17: 25,342,257 (GRCm39) Q244L possibly damaging Het
Rab3gap1 A G 1: 127,858,495 (GRCm39) T535A probably benign Het
Ranbp2 T C 10: 58,313,117 (GRCm39) F1279S probably damaging Het
Rgl1 T C 1: 152,428,362 (GRCm39) H254R probably damaging Het
Rida C T 15: 34,487,909 (GRCm39) A69T probably damaging Het
Scn2a T C 2: 65,511,346 (GRCm39) F131L probably benign Het
Septin1 T C 7: 126,816,092 (GRCm39) I141V probably benign Het
Slc10a6 A G 5: 103,765,571 (GRCm39) S171P probably damaging Het
Slc18a1 A G 8: 69,519,790 (GRCm39) probably null Het
Slc38a6 T C 12: 73,388,526 (GRCm39) S247P possibly damaging Het
Tet2 A T 3: 133,187,147 (GRCm39) I1094K possibly damaging Het
Tmem234 C T 4: 129,501,333 (GRCm39) S138L probably benign Het
Trpv1 T A 11: 73,145,148 (GRCm39) probably null Het
Vmn2r60 T A 7: 41,844,935 (GRCm39) M766K probably damaging Het
Vmn2r84 T C 10: 130,226,843 (GRCm39) N332D probably benign Het
Zfp292 A T 4: 34,819,563 (GRCm39) I258N probably damaging Het
Zxdc A G 6: 90,375,773 (GRCm39) K750E probably damaging Het
Other mutations in Bbs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Bbs12 APN 3 37,374,346 (GRCm39) missense probably damaging 1.00
IGL00698:Bbs12 APN 3 37,374,943 (GRCm39) missense probably benign 0.00
IGL02105:Bbs12 APN 3 37,374,296 (GRCm39) missense probably damaging 1.00
IGL02110:Bbs12 APN 3 37,373,336 (GRCm39) missense probably benign 0.01
IGL03036:Bbs12 APN 3 37,373,343 (GRCm39) missense possibly damaging 0.86
haribo UTSW 3 37,374,529 (GRCm39) missense probably damaging 1.00
R0310:Bbs12 UTSW 3 37,375,194 (GRCm39) missense probably damaging 1.00
R1888:Bbs12 UTSW 3 37,374,712 (GRCm39) missense probably damaging 1.00
R1888:Bbs12 UTSW 3 37,374,712 (GRCm39) missense probably damaging 1.00
R2061:Bbs12 UTSW 3 37,373,215 (GRCm39) missense probably damaging 0.97
R2152:Bbs12 UTSW 3 37,375,309 (GRCm39) nonsense probably null
R4455:Bbs12 UTSW 3 37,374,461 (GRCm39) missense probably damaging 1.00
R4472:Bbs12 UTSW 3 37,373,369 (GRCm39) missense possibly damaging 0.95
R4762:Bbs12 UTSW 3 37,374,529 (GRCm39) missense probably damaging 1.00
R5208:Bbs12 UTSW 3 37,374,422 (GRCm39) missense probably benign 0.07
R5841:Bbs12 UTSW 3 37,373,670 (GRCm39) missense probably benign 0.05
R5864:Bbs12 UTSW 3 37,373,639 (GRCm39) missense probably damaging 1.00
R5872:Bbs12 UTSW 3 37,374,598 (GRCm39) missense possibly damaging 0.83
R5941:Bbs12 UTSW 3 37,374,197 (GRCm39) missense probably damaging 0.98
R5954:Bbs12 UTSW 3 37,374,151 (GRCm39) missense possibly damaging 0.95
R6125:Bbs12 UTSW 3 37,374,700 (GRCm39) missense probably benign 0.01
R6562:Bbs12 UTSW 3 37,374,389 (GRCm39) missense probably damaging 1.00
R6886:Bbs12 UTSW 3 37,373,390 (GRCm39) missense probably damaging 1.00
R7454:Bbs12 UTSW 3 37,375,102 (GRCm39) missense possibly damaging 0.95
R9130:Bbs12 UTSW 3 37,373,205 (GRCm39) intron probably benign
R9288:Bbs12 UTSW 3 37,374,712 (GRCm39) missense probably damaging 1.00
R9404:Bbs12 UTSW 3 37,373,557 (GRCm39) missense probably damaging 0.99
R9753:Bbs12 UTSW 3 37,373,680 (GRCm39) missense possibly damaging 0.79
R9792:Bbs12 UTSW 3 37,374,224 (GRCm39) missense possibly damaging 0.59
R9795:Bbs12 UTSW 3 37,374,224 (GRCm39) missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCTAGGACATTCATTCAACAACATG -3'
(R):5'- AGAATGGCAGTTATTGATAGACATC -3'

Sequencing Primer
(F):5'- GTACAAAATGCCATTGACTCTGG -3'
(R):5'- TTATAGCTCCAGGGGATCCAATC -3'
Posted On 2022-02-07