Incidental Mutation 'R9190:Clca3a2'
ID 697668
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9190 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144502320-144525255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 144796599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 203 (V203I)
Ref Sequence ENSEMBL: ENSMUSP00000036029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]
AlphaFold Q9EQR4
Predicted Effect probably benign
Transcript: ENSMUST00000040465
AA Change: V203I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: V203I

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
VWA 309 485 3.55e-5 SMART
low complexity region 739 754 N/A INTRINSIC
Blast:FN3 765 875 5e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198993
AA Change: V203I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: V203I

DomainStartEndE-ValueType
Pfam:CLCA_N 7 265 1.7e-121 PFAM
VWA 309 485 2.2e-7 SMART
Pfam:DUF1973 494 674 7.8e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,642,880 (GRCm39) T183I possibly damaging Het
Abca13 T A 11: 9,241,886 (GRCm39) S1250T probably damaging Het
Adamts12 T A 15: 11,336,446 (GRCm39) S1510R probably benign Het
Adcy5 T A 16: 35,089,364 (GRCm39) C520* probably null Het
Arhgap21 A T 2: 20,858,983 (GRCm39) M1237K probably null Het
Atp8b4 T A 2: 126,225,607 (GRCm39) N541I probably damaging Het
Bbs12 G T 3: 37,375,223 (GRCm39) R557L probably damaging Het
Bcl7c T C 7: 127,266,200 (GRCm39) T183A probably benign Het
Brd7 A G 8: 89,081,274 (GRCm39) S192P probably damaging Het
Calhm3 G A 19: 47,146,121 (GRCm39) A28V probably benign Het
Ccdc113 A G 8: 96,263,101 (GRCm39) N37S probably damaging Het
Cdh5 T G 8: 104,867,337 (GRCm39) V538G probably damaging Het
Cfap43 T C 19: 47,726,293 (GRCm39) E1639G possibly damaging Het
Clstn2 A G 9: 97,414,815 (GRCm39) F360L probably damaging Het
Cnst GTGACACGCTTG GTG 1: 179,407,039 (GRCm39) probably benign Het
Cog2 T C 8: 125,260,058 (GRCm39) Y234H probably damaging Het
Ddhd2 T C 8: 26,244,495 (GRCm39) S44G probably benign Het
Dync2i2 G T 2: 29,922,211 (GRCm39) H417N probably benign Het
Farp1 A G 14: 121,492,988 (GRCm39) E530G probably damaging Het
Fhad1 C T 4: 141,646,058 (GRCm39) probably null Het
Foxj3 T A 4: 119,477,538 (GRCm39) C449* probably null Het
Fsbp G C 4: 11,584,005 (GRCm39) V235L probably benign Het
Fuom T C 7: 139,681,252 (GRCm39) E73G probably benign Het
Gm5134 A G 10: 75,844,645 (GRCm39) H667R probably damaging Het
Igsf21 A G 4: 139,756,028 (GRCm39) I361T probably damaging Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Kmt2d A T 15: 98,749,896 (GRCm39) V2599E unknown Het
Lama1 T A 17: 68,111,514 (GRCm39) M2255K Het
Litafd C A 16: 8,501,647 (GRCm39) P50T Het
Lrrc32 A G 7: 98,148,234 (GRCm39) H338R probably benign Het
Map1b C A 13: 99,571,914 (GRCm39) R269L probably damaging Het
Ms4a5 T A 19: 11,256,733 (GRCm39) I55F probably damaging Het
Muc5b G C 7: 141,411,939 (GRCm39) L1628F unknown Het
Myo6 A G 9: 80,195,384 (GRCm39) Q918R unknown Het
Or1e25 T A 11: 73,493,877 (GRCm39) M157K probably benign Het
Or2t48 A G 11: 58,420,161 (GRCm39) V217A possibly damaging Het
Or5m11b T A 2: 85,805,884 (GRCm39) I99N possibly damaging Het
Or9i1b T G 19: 13,896,967 (GRCm39) N194K probably benign Het
Pals2 A G 6: 50,157,219 (GRCm39) R296G probably damaging Het
Plin5 A G 17: 56,419,462 (GRCm39) V320A probably damaging Het
Ptx4 A T 17: 25,342,257 (GRCm39) Q244L possibly damaging Het
Rab3gap1 A G 1: 127,858,495 (GRCm39) T535A probably benign Het
Ranbp2 T C 10: 58,313,117 (GRCm39) F1279S probably damaging Het
Rgl1 T C 1: 152,428,362 (GRCm39) H254R probably damaging Het
Rida C T 15: 34,487,909 (GRCm39) A69T probably damaging Het
Scn2a T C 2: 65,511,346 (GRCm39) F131L probably benign Het
Septin1 T C 7: 126,816,092 (GRCm39) I141V probably benign Het
Slc10a6 A G 5: 103,765,571 (GRCm39) S171P probably damaging Het
Slc18a1 A G 8: 69,519,790 (GRCm39) probably null Het
Slc38a6 T C 12: 73,388,526 (GRCm39) S247P possibly damaging Het
Tet2 A T 3: 133,187,147 (GRCm39) I1094K possibly damaging Het
Tmem234 C T 4: 129,501,333 (GRCm39) S138L probably benign Het
Trpv1 T A 11: 73,145,148 (GRCm39) probably null Het
Vmn2r60 T A 7: 41,844,935 (GRCm39) M766K probably damaging Het
Vmn2r84 T C 10: 130,226,843 (GRCm39) N332D probably benign Het
Zfp292 A T 4: 34,819,563 (GRCm39) I258N probably damaging Het
Zxdc A G 6: 90,375,773 (GRCm39) K750E probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca3a2 APN 3 144,804,574 (GRCm39) missense probably damaging 1.00
IGL01019:Clca3a2 APN 3 144,519,388 (GRCm39) nonsense probably null
IGL01337:Clca3a2 APN 3 144,800,939 (GRCm39) missense probably damaging 1.00
IGL01389:Clca3a2 APN 3 144,783,629 (GRCm39) critical splice donor site probably null
IGL01595:Clca3a2 APN 3 144,793,768 (GRCm39) missense probably damaging 1.00
IGL01663:Clca3a2 APN 3 144,522,916 (GRCm39) missense probably damaging 0.97
IGL01704:Clca3a2 APN 3 144,800,979 (GRCm39) missense probably benign 0.04
IGL01779:Clca3a2 APN 3 144,525,139 (GRCm39) missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144,519,216 (GRCm39) missense probably benign
IGL02301:Clca3a2 APN 3 144,512,133 (GRCm39) missense probably damaging 0.98
IGL02416:Clca3a2 APN 3 144,790,777 (GRCm39) missense probably benign 0.02
IGL02455:Clca3a2 APN 3 144,787,172 (GRCm39) missense probably benign 0.00
IGL02481:Clca3a2 APN 3 144,790,701 (GRCm39) missense possibly damaging 0.92
IGL02526:Clca3a2 APN 3 144,793,779 (GRCm39) missense probably benign 0.02
IGL02619:Clca3a2 APN 3 144,512,083 (GRCm39) missense probably damaging 1.00
IGL02797:Clca3a2 APN 3 144,787,024 (GRCm39) missense probably benign 0.02
IGL02852:Clca3a2 APN 3 144,512,104 (GRCm39) missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144,522,529 (GRCm39) missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144,512,177 (GRCm39) missense probably damaging 1.00
IGL03253:Clca3a2 APN 3 144,777,324 (GRCm39) missense probably benign 0.41
IGL03256:Clca3a2 APN 3 144,792,153 (GRCm39) missense possibly damaging 0.75
IGL03294:Clca3a2 APN 3 144,803,530 (GRCm39) missense probably damaging 1.00
3370:Clca3a2 UTSW 3 144,783,738 (GRCm39) missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144,522,494 (GRCm39) missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144,519,659 (GRCm39) missense possibly damaging 0.90
R0479:Clca3a2 UTSW 3 144,796,610 (GRCm39) missense probably damaging 1.00
R0542:Clca3a2 UTSW 3 144,781,571 (GRCm39) splice site probably benign
R0629:Clca3a2 UTSW 3 144,778,000 (GRCm39) missense probably benign
R1249:Clca3a2 UTSW 3 144,508,765 (GRCm39) missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144,519,624 (GRCm39) splice site probably benign
R1488:Clca3a2 UTSW 3 144,789,925 (GRCm39) missense possibly damaging 0.49
R1523:Clca3a2 UTSW 3 144,777,405 (GRCm39) nonsense probably null
R1568:Clca3a2 UTSW 3 144,781,410 (GRCm39) nonsense probably null
R1586:Clca3a2 UTSW 3 144,516,477 (GRCm39) missense possibly damaging 0.94
R1650:Clca3a2 UTSW 3 144,797,973 (GRCm39) missense probably damaging 1.00
R1771:Clca3a2 UTSW 3 144,787,171 (GRCm39) missense probably benign 0.12
R1776:Clca3a2 UTSW 3 144,519,681 (GRCm39) missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144,512,164 (GRCm39) missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144,516,457 (GRCm39) missense probably benign
R1923:Clca3a2 UTSW 3 144,511,491 (GRCm39) missense probably damaging 1.00
R2101:Clca3a2 UTSW 3 144,783,699 (GRCm39) missense probably damaging 0.99
R2200:Clca3a2 UTSW 3 144,519,685 (GRCm39) missense probably benign 0.10
R2242:Clca3a2 UTSW 3 144,796,551 (GRCm39) missense probably damaging 0.98
R2324:Clca3a2 UTSW 3 144,512,041 (GRCm39) critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144,519,679 (GRCm39) missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144,512,088 (GRCm39) missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144,514,522 (GRCm39) unclassified probably benign
R3551:Clca3a2 UTSW 3 144,508,842 (GRCm39) missense probably damaging 1.00
R3751:Clca3a2 UTSW 3 144,777,216 (GRCm39) missense probably benign 0.04
R3952:Clca3a2 UTSW 3 144,508,822 (GRCm39) missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144,512,081 (GRCm39) missense probably benign 0.02
R4496:Clca3a2 UTSW 3 144,797,926 (GRCm39) missense possibly damaging 0.94
R4518:Clca3a2 UTSW 3 144,514,466 (GRCm39) missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144,511,444 (GRCm39) missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144,523,692 (GRCm39) missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144,512,263 (GRCm39) missense probably damaging 1.00
R4962:Clca3a2 UTSW 3 144,783,640 (GRCm39) missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144,512,104 (GRCm39) missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144,511,599 (GRCm39) missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R5344:Clca3a2 UTSW 3 144,793,703 (GRCm39) missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144,503,286 (GRCm39) missense probably benign 0.00
R5424:Clca3a2 UTSW 3 144,789,942 (GRCm39) missense probably damaging 0.99
R5656:Clca3a2 UTSW 3 144,503,393 (GRCm39) missense probably benign 0.26
R5931:Clca3a2 UTSW 3 144,797,886 (GRCm39) missense possibly damaging 0.88
R6059:Clca3a2 UTSW 3 144,516,531 (GRCm39) missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144,525,118 (GRCm39) missense probably damaging 0.99
R6181:Clca3a2 UTSW 3 144,796,469 (GRCm39) nonsense probably null
R6254:Clca3a2 UTSW 3 144,507,895 (GRCm39) missense probably benign
R6336:Clca3a2 UTSW 3 144,512,239 (GRCm39) missense probably benign
R6470:Clca3a2 UTSW 3 144,510,024 (GRCm39) splice site probably null
R6593:Clca3a2 UTSW 3 144,514,338 (GRCm39) critical splice donor site probably null
R6598:Clca3a2 UTSW 3 144,792,246 (GRCm39) nonsense probably null
R6631:Clca3a2 UTSW 3 144,519,405 (GRCm39) missense probably benign
R6826:Clca3a2 UTSW 3 144,523,815 (GRCm39) missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144,512,144 (GRCm39) missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144,514,462 (GRCm39) missense probably damaging 1.00
R7167:Clca3a2 UTSW 3 144,803,545 (GRCm39) missense probably benign 0.40
R7211:Clca3a2 UTSW 3 144,519,775 (GRCm39) missense probably benign 0.00
R7229:Clca3a2 UTSW 3 144,789,869 (GRCm39) missense probably damaging 1.00
R7256:Clca3a2 UTSW 3 144,796,608 (GRCm39) missense probably damaging 0.99
R7324:Clca3a2 UTSW 3 144,514,372 (GRCm39) missense probably damaging 0.99
R7365:Clca3a2 UTSW 3 144,804,545 (GRCm39) missense probably damaging 1.00
R7411:Clca3a2 UTSW 3 144,507,860 (GRCm39) missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144,503,362 (GRCm39) missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144,507,674 (GRCm39) makesense probably null
R7813:Clca3a2 UTSW 3 144,790,726 (GRCm39) missense probably benign 0.26
R7889:Clca3a2 UTSW 3 144,516,574 (GRCm39) nonsense probably null
R7946:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144,519,756 (GRCm39) missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144,511,527 (GRCm39) missense probably damaging 1.00
R8077:Clca3a2 UTSW 3 144,777,288 (GRCm39) missense possibly damaging 0.56
R8169:Clca3a2 UTSW 3 144,783,653 (GRCm39) missense probably damaging 1.00
R8290:Clca3a2 UTSW 3 144,793,719 (GRCm39) missense possibly damaging 0.93
R8300:Clca3a2 UTSW 3 144,804,692 (GRCm39) missense probably benign 0.00
R8344:Clca3a2 UTSW 3 144,511,703 (GRCm39) critical splice acceptor site probably null
R8350:Clca3a2 UTSW 3 144,783,668 (GRCm39) missense probably benign 0.19
R8367:Clca3a2 UTSW 3 144,523,508 (GRCm39) splice site probably null
R8371:Clca3a2 UTSW 3 144,513,114 (GRCm39) nonsense probably null
R8814:Clca3a2 UTSW 3 144,503,525 (GRCm39) missense probably benign 0.18
R8854:Clca3a2 UTSW 3 144,783,852 (GRCm39) missense possibly damaging 0.94
R8876:Clca3a2 UTSW 3 144,777,360 (GRCm39) missense probably benign 0.00
R8887:Clca3a2 UTSW 3 144,790,810 (GRCm39) nonsense probably null
R9006:Clca3a2 UTSW 3 144,783,789 (GRCm39) missense probably damaging 0.99
R9031:Clca3a2 UTSW 3 144,511,475 (GRCm39) missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144,519,447 (GRCm39) splice site probably benign
R9093:Clca3a2 UTSW 3 144,781,481 (GRCm39) missense probably benign 0.20
R9201:Clca3a2 UTSW 3 144,519,684 (GRCm39) missense probably benign 0.00
R9209:Clca3a2 UTSW 3 144,778,005 (GRCm39) missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144,525,158 (GRCm39) missense probably benign
R9469:Clca3a2 UTSW 3 144,507,938 (GRCm39) missense probably damaging 1.00
R9501:Clca3a2 UTSW 3 144,777,322 (GRCm39) nonsense probably null
R9515:Clca3a2 UTSW 3 144,508,808 (GRCm39) nonsense probably null
R9569:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144,503,575 (GRCm39) missense probably damaging 1.00
X0025:Clca3a2 UTSW 3 144,792,265 (GRCm39) missense possibly damaging 0.87
Z1177:Clca3a2 UTSW 3 144,792,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTTTGTCGTCCCAAGG -3'
(R):5'- TGGCAATACAAATGCTTGTCC -3'

Sequencing Primer
(F):5'- GTCGTCCCAAGGATGTACTTACAG -3'
(R):5'- TGCTTGTCCAAATTCAAGGC -3'
Posted On 2022-02-07