Incidental Mutation 'R9192:Stk32b'
ID 697735
Institutional Source Beutler Lab
Gene Symbol Stk32b
Ensembl Gene ENSMUSG00000029123
Gene Name serine/threonine kinase 32B
Synonyms YANK2, 2510009F08Rik, Stk32, STKG6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9192 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 37446825-37717171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37629000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000092432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094836]
AlphaFold Q9JJX8
Predicted Effect probably damaging
Transcript: ENSMUST00000094836
AA Change: V40A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092432
Gene: ENSMUSG00000029123
AA Change: V40A

DomainStartEndE-ValueType
S_TKc 23 283 1.18e-84 SMART
low complexity region 323 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine protein kinase. Serine-threonine kinases transfer phosphate molecules to the oxygen atoms of serine and threonine. A genomic deletion affecting this gene has been associated with Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,704,501 M71K probably benign Het
Angptl4 C T 17: 33,781,311 A28T probably benign Het
Baz1b T G 5: 135,210,794 N249K possibly damaging Het
BC035947 A T 1: 78,499,240 Y218* probably null Het
Ctbp1 T C 5: 33,250,989 I211V probably benign Het
Dars T C 1: 128,372,152 E365G probably benign Het
E2f7 G T 10: 110,763,990 R202L probably damaging Het
Fscb A C 12: 64,474,116 I192S possibly damaging Het
Fsip2 A G 2: 82,987,500 I4526V probably benign Het
Gm9008 T C 6: 76,496,583 D350G probably benign Het
Gucy2e A T 11: 69,236,477 F57I probably damaging Het
Hcar2 A T 5: 123,865,291 C50S possibly damaging Het
Herc1 G A 9: 66,414,131 V1267I probably benign Het
Kansl1 A T 11: 104,336,316 D845E probably damaging Het
Kdm2b T A 5: 122,932,616 T473S probably benign Het
Klhdc10 T A 6: 30,449,500 I327N probably damaging Het
Kmt5b T C 19: 3,804,442 L235P probably damaging Het
Lama2 C T 10: 27,328,185 E486K possibly damaging Het
Lhx6 A T 2: 36,091,133 W266R probably benign Het
Mettl15 A T 2: 109,274,465 L65* probably null Het
Mocos A G 18: 24,679,537 Q496R probably benign Het
Neb T C 2: 52,313,835 S285G probably damaging Het
Nos3 A G 5: 24,377,613 N613S probably benign Het
Nphs2 G A 1: 156,310,816 R10Q probably benign Het
Olfr1274-ps C A 2: 90,401,372 T237N probably damaging Het
Olfr641 A T 7: 104,040,668 I291F possibly damaging Het
Olfr698 A G 7: 106,753,223 L55P probably damaging Het
Osbpl10 T C 9: 115,167,226 C119R probably damaging Het
Otop1 T C 5: 38,287,930 V144A probably benign Het
Ovca2 A G 11: 75,178,036 V179A possibly damaging Het
Pcdha11 A G 18: 37,007,474 T719A probably benign Het
Pcdhga1 A G 18: 37,840,031 N900D probably damaging Het
Pcdhga8 A T 18: 37,726,110 Q73L probably damaging Het
Pclo A G 5: 14,540,190 K835E unknown Het
Psmd2 T A 16: 20,654,662 Y158N probably damaging Het
Pygl A G 12: 70,197,048 V631A probably damaging Het
Rhoq A T 17: 86,996,977 I179F Het
Rps6kb1 T C 11: 86,513,555 I257M probably damaging Het
Sall3 G A 18: 80,973,909 A268V probably benign Het
Serinc4 G A 2: 121,456,769 probably benign Het
Slc27a2 T A 2: 126,587,887 M605K probably damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Slc6a7 A G 18: 61,000,577 Y516H probably damaging Het
Spag16 A G 1: 69,923,848 T385A unknown Het
Stat6 G A 10: 127,657,610 R600H probably damaging Het
Sv2c T A 13: 96,088,247 I185L probably benign Het
Syne2 T A 12: 76,109,929 L2115H probably damaging Het
Tas2r121 T C 6: 132,700,529 E160G probably benign Het
Tle1 G T 4: 72,118,516 T727K probably benign Het
Tmem79 A T 3: 88,333,457 D61E probably benign Het
Tnrc18 C A 5: 142,787,847 R409L Het
Tnrc6a C A 7: 123,189,953 P1665Q probably damaging Het
Tns2 C A 15: 102,112,981 P1027Q probably damaging Het
Trav7-5 C G 14: 53,531,158 A61G probably benign Het
Ttn A G 2: 76,914,911 S5265P possibly damaging Het
Tuba1c T A 15: 99,037,856 Y399* probably null Het
Vav2 A T 2: 27,282,382 I504N probably damaging Het
Vmn2r5 G T 3: 64,491,517 C680* probably null Het
Zfp644 G C 5: 106,637,963 S239R probably benign Het
Zfp954 C T 7: 7,115,934 G204S probably damaging Het
Zswim8 C T 14: 20,719,520 T1265I probably damaging Het
Other mutations in Stk32b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Stk32b APN 5 37499030 splice site probably benign
IGL02525:Stk32b APN 5 37531633 missense probably damaging 1.00
IGL02946:Stk32b APN 5 37531539 splice site probably benign
IGL03277:Stk32b APN 5 37628976 missense probably damaging 0.99
flank UTSW 5 37466781 missense probably damaging 1.00
H8441:Stk32b UTSW 5 37457234 missense probably damaging 1.00
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0601:Stk32b UTSW 5 37531566 missense probably damaging 1.00
R0879:Stk32b UTSW 5 37459596 splice site probably benign
R1812:Stk32b UTSW 5 37466758 missense probably damaging 1.00
R1882:Stk32b UTSW 5 37531687 missense possibly damaging 0.91
R1982:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R3899:Stk32b UTSW 5 37457154 missense probably damaging 1.00
R4724:Stk32b UTSW 5 37454934 critical splice donor site probably null
R4885:Stk32b UTSW 5 37466797 missense probably damaging 1.00
R5531:Stk32b UTSW 5 37459734 splice site probably null
R5629:Stk32b UTSW 5 37457232 missense probably damaging 1.00
R6042:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R6610:Stk32b UTSW 5 37448678 missense probably benign 0.04
R6864:Stk32b UTSW 5 37448805 splice site probably null
R6879:Stk32b UTSW 5 37490523 missense possibly damaging 0.77
R7186:Stk32b UTSW 5 37466781 missense probably damaging 1.00
R8317:Stk32b UTSW 5 37454975 missense probably damaging 0.99
R8676:Stk32b UTSW 5 37457159 missense probably benign 0.00
R8795:Stk32b UTSW 5 37649139 missense probably damaging 0.98
R8948:Stk32b UTSW 5 37454997 missense possibly damaging 0.87
V1024:Stk32b UTSW 5 37457234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGACACTTGGATCCTTTC -3'
(R):5'- GCTTAGCCAATATGCTTCACTAG -3'

Sequencing Primer
(F):5'- GCAGTGCCAAGACACCATTC -3'
(R):5'- CTTCACTAGCAAGCGGTTGGAATG -3'
Posted On 2022-02-07