Incidental Mutation 'R9192:Sv2c'
ID 697762
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9192 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96224755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 185 (I185L)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: I185L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: I185L

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: I185L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: I185L

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,354,249 (GRCm39) M71K probably benign Het
Angptl4 C T 17: 34,000,285 (GRCm39) A28T probably benign Het
Baz1b T G 5: 135,239,648 (GRCm39) N249K possibly damaging Het
BC035947 A T 1: 78,475,877 (GRCm39) Y218* probably null Het
Ctbp1 T C 5: 33,408,333 (GRCm39) I211V probably benign Het
Dars1 T C 1: 128,299,889 (GRCm39) E365G probably benign Het
E2f7 G T 10: 110,599,851 (GRCm39) R202L probably damaging Het
Fscb A C 12: 64,520,890 (GRCm39) I192S possibly damaging Het
Fsip2 A G 2: 82,817,844 (GRCm39) I4526V probably benign Het
Gucy2e A T 11: 69,127,303 (GRCm39) F57I probably damaging Het
Hcar2 A T 5: 124,003,354 (GRCm39) C50S possibly damaging Het
Herc1 G A 9: 66,321,413 (GRCm39) V1267I probably benign Het
Kansl1 A T 11: 104,227,142 (GRCm39) D845E probably damaging Het
Kdm2b T A 5: 123,070,679 (GRCm39) T473S probably benign Het
Klhdc10 T A 6: 30,449,499 (GRCm39) I327N probably damaging Het
Kmt5b T C 19: 3,854,442 (GRCm39) L235P probably damaging Het
Lama2 C T 10: 27,204,181 (GRCm39) E486K possibly damaging Het
Lhx6 A T 2: 35,981,145 (GRCm39) W266R probably benign Het
Mettl15 A T 2: 109,104,810 (GRCm39) L65* probably null Het
Mocos A G 18: 24,812,594 (GRCm39) Q496R probably benign Het
Neb T C 2: 52,203,847 (GRCm39) S285G probably damaging Het
Nos3 A G 5: 24,582,611 (GRCm39) N613S probably benign Het
Nphs2 G A 1: 156,138,386 (GRCm39) R10Q probably benign Het
Or2ag16 A G 7: 106,352,430 (GRCm39) L55P probably damaging Het
Or4x13 C A 2: 90,231,716 (GRCm39) T237N probably damaging Het
Or51i2 A T 7: 103,689,875 (GRCm39) I291F possibly damaging Het
Osbpl10 T C 9: 114,996,294 (GRCm39) C119R probably damaging Het
Otop1 T C 5: 38,445,274 (GRCm39) V144A probably benign Het
Ovca2 A G 11: 75,068,862 (GRCm39) V179A possibly damaging Het
Pcdha11 A G 18: 37,140,527 (GRCm39) T719A probably benign Het
Pcdhga1 A G 18: 37,973,084 (GRCm39) N900D probably damaging Het
Pcdhga8 A T 18: 37,859,163 (GRCm39) Q73L probably damaging Het
Pclo A G 5: 14,590,204 (GRCm39) K835E unknown Het
Psmd2 T A 16: 20,473,412 (GRCm39) Y158N probably damaging Het
Pygl A G 12: 70,243,822 (GRCm39) V631A probably damaging Het
Rhoq A T 17: 87,304,405 (GRCm39) I179F Het
Rnf26rt T C 6: 76,473,566 (GRCm39) D350G probably benign Het
Rps6kb1 T C 11: 86,404,381 (GRCm39) I257M probably damaging Het
Sall3 G A 18: 81,017,124 (GRCm39) A268V probably benign Het
Serinc4 G A 2: 121,287,250 (GRCm39) probably benign Het
Slc27a2 T A 2: 126,429,807 (GRCm39) M605K probably damaging Het
Slc5a7 T C 17: 54,594,389 (GRCm39) I197M probably benign Het
Slc6a7 A G 18: 61,133,649 (GRCm39) Y516H probably damaging Het
Spag16 A G 1: 69,963,007 (GRCm39) T385A unknown Het
Stat6 G A 10: 127,493,479 (GRCm39) R600H probably damaging Het
Stk32b A G 5: 37,786,344 (GRCm39) V40A probably damaging Het
Syne2 T A 12: 76,156,703 (GRCm39) L2115H probably damaging Het
Tas2r121 T C 6: 132,677,492 (GRCm39) E160G probably benign Het
Tle1 G T 4: 72,036,753 (GRCm39) T727K probably benign Het
Tmem79 A T 3: 88,240,764 (GRCm39) D61E probably benign Het
Tnrc18 C A 5: 142,773,602 (GRCm39) R409L Het
Tnrc6a C A 7: 122,789,176 (GRCm39) P1665Q probably damaging Het
Tns2 C A 15: 102,021,416 (GRCm39) P1027Q probably damaging Het
Trav7-5 C G 14: 53,768,615 (GRCm39) A61G probably benign Het
Ttn A G 2: 76,745,255 (GRCm39) S5265P possibly damaging Het
Tuba1c T A 15: 98,935,737 (GRCm39) Y399* probably null Het
Vav2 A T 2: 27,172,394 (GRCm39) I504N probably damaging Het
Vmn2r5 G T 3: 64,398,938 (GRCm39) C680* probably null Het
Zfp644 G C 5: 106,785,829 (GRCm39) S239R probably benign Het
Zfp954 C T 7: 7,118,933 (GRCm39) G204S probably damaging Het
Zswim8 C T 14: 20,769,588 (GRCm39) T1265I probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTAATGATGGCTACATAAAACCTG -3'
(R):5'- GTGATGAGTACAAGGACCGC -3'

Sequencing Primer
(F):5'- GCATGATATCTGATATGCAGCCCTG -3'
(R):5'- ACCGCAGAGAGCTAGAGTC -3'
Posted On 2022-02-07