Incidental Mutation 'R9192:Mocos'
ID 697771
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Name molybdenum cofactor sulfurase
Synonyms 1110018O12Rik
Accession Numbers

NCBI RefSeq: NM_026779.1; MGI:1915841

Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R9192 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 24653691-24701556 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24679537 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 496 (Q496R)
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
AlphaFold Q14CH1
Predicted Effect probably benign
Transcript: ENSMUST00000068006
AA Change: Q496R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616
AA Change: Q496R

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,704,501 M71K probably benign Het
Angptl4 C T 17: 33,781,311 A28T probably benign Het
Baz1b T G 5: 135,210,794 N249K possibly damaging Het
BC035947 A T 1: 78,499,240 Y218* probably null Het
Ctbp1 T C 5: 33,250,989 I211V probably benign Het
Dars T C 1: 128,372,152 E365G probably benign Het
E2f7 G T 10: 110,763,990 R202L probably damaging Het
Fscb A C 12: 64,474,116 I192S possibly damaging Het
Fsip2 A G 2: 82,987,500 I4526V probably benign Het
Gm9008 T C 6: 76,496,583 D350G probably benign Het
Gucy2e A T 11: 69,236,477 F57I probably damaging Het
Hcar2 A T 5: 123,865,291 C50S possibly damaging Het
Herc1 G A 9: 66,414,131 V1267I probably benign Het
Kansl1 A T 11: 104,336,316 D845E probably damaging Het
Kdm2b T A 5: 122,932,616 T473S probably benign Het
Klhdc10 T A 6: 30,449,500 I327N probably damaging Het
Kmt5b T C 19: 3,804,442 L235P probably damaging Het
Lama2 C T 10: 27,328,185 E486K possibly damaging Het
Lhx6 A T 2: 36,091,133 W266R probably benign Het
Mettl15 A T 2: 109,274,465 L65* probably null Het
Neb T C 2: 52,313,835 S285G probably damaging Het
Nos3 A G 5: 24,377,613 N613S probably benign Het
Nphs2 G A 1: 156,310,816 R10Q probably benign Het
Olfr1274-ps C A 2: 90,401,372 T237N probably damaging Het
Olfr641 A T 7: 104,040,668 I291F possibly damaging Het
Olfr698 A G 7: 106,753,223 L55P probably damaging Het
Osbpl10 T C 9: 115,167,226 C119R probably damaging Het
Otop1 T C 5: 38,287,930 V144A probably benign Het
Ovca2 A G 11: 75,178,036 V179A possibly damaging Het
Pcdha11 A G 18: 37,007,474 T719A probably benign Het
Pcdhga1 A G 18: 37,840,031 N900D probably damaging Het
Pcdhga8 A T 18: 37,726,110 Q73L probably damaging Het
Pclo A G 5: 14,540,190 K835E unknown Het
Psmd2 T A 16: 20,654,662 Y158N probably damaging Het
Pygl A G 12: 70,197,048 V631A probably damaging Het
Rhoq A T 17: 86,996,977 I179F Het
Rps6kb1 T C 11: 86,513,555 I257M probably damaging Het
Sall3 G A 18: 80,973,909 A268V probably benign Het
Serinc4 G A 2: 121,456,769 probably benign Het
Slc27a2 T A 2: 126,587,887 M605K probably damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Slc6a7 A G 18: 61,000,577 Y516H probably damaging Het
Spag16 A G 1: 69,923,848 T385A unknown Het
Stat6 G A 10: 127,657,610 R600H probably damaging Het
Stk32b A G 5: 37,629,000 V40A probably damaging Het
Sv2c T A 13: 96,088,247 I185L probably benign Het
Syne2 T A 12: 76,109,929 L2115H probably damaging Het
Tas2r121 T C 6: 132,700,529 E160G probably benign Het
Tle1 G T 4: 72,118,516 T727K probably benign Het
Tmem79 A T 3: 88,333,457 D61E probably benign Het
Tnrc18 C A 5: 142,787,847 R409L Het
Tnrc6a C A 7: 123,189,953 P1665Q probably damaging Het
Tns2 C A 15: 102,112,981 P1027Q probably damaging Het
Trav7-5 C G 14: 53,531,158 A61G probably benign Het
Ttn A G 2: 76,914,911 S5265P possibly damaging Het
Tuba1c T A 15: 99,037,856 Y399* probably null Het
Vav2 A T 2: 27,282,382 I504N probably damaging Het
Vmn2r5 G T 3: 64,491,517 C680* probably null Het
Zfp644 G C 5: 106,637,963 S239R probably benign Het
Zfp954 C T 7: 7,115,934 G204S probably damaging Het
Zswim8 C T 14: 20,719,520 T1265I probably damaging Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24660044 missense possibly damaging 0.88
IGL01859:Mocos APN 18 24666660 splice site probably benign
IGL01884:Mocos APN 18 24683216 missense probably damaging 1.00
IGL02174:Mocos APN 18 24695896 missense probably benign 0.00
IGL02966:Mocos APN 18 24676611 missense probably damaging 1.00
IGL02976:Mocos APN 18 24666569 missense possibly damaging 0.92
buteo UTSW 18 24666410 missense probably damaging 0.98
swainson UTSW 18 24679390 missense probably damaging 1.00
P0008:Mocos UTSW 18 24679606 missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24686702 missense probably damaging 1.00
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0132:Mocos UTSW 18 24679762 missense probably benign 0.01
R0265:Mocos UTSW 18 24666276 missense probably benign 0.01
R0737:Mocos UTSW 18 24688987 missense probably damaging 0.98
R1231:Mocos UTSW 18 24679701 missense probably benign 0.01
R1351:Mocos UTSW 18 24660050 missense probably damaging 1.00
R1699:Mocos UTSW 18 24683216 missense probably damaging 1.00
R1853:Mocos UTSW 18 24695969 missense probably damaging 1.00
R2190:Mocos UTSW 18 24664057 missense probably benign 0.01
R2350:Mocos UTSW 18 24666656 splice site probably benign
R2680:Mocos UTSW 18 24676629 missense probably damaging 1.00
R3840:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3841:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3847:Mocos UTSW 18 24676662 missense probably damaging 0.99
R4059:Mocos UTSW 18 24679390 missense probably damaging 1.00
R4158:Mocos UTSW 18 24674246 missense probably damaging 0.99
R4205:Mocos UTSW 18 24666191 missense possibly damaging 0.88
R4514:Mocos UTSW 18 24683212 missense probably damaging 0.99
R4589:Mocos UTSW 18 24654038 missense probably damaging 0.99
R4667:Mocos UTSW 18 24666434 missense probably benign 0.11
R4668:Mocos UTSW 18 24666434 missense probably benign 0.11
R5162:Mocos UTSW 18 24654052 missense probably damaging 0.98
R5187:Mocos UTSW 18 24692554 missense probably damaging 0.97
R5533:Mocos UTSW 18 24674300 missense probably damaging 1.00
R5629:Mocos UTSW 18 24664085 critical splice donor site probably null
R5661:Mocos UTSW 18 24665995 splice site probably null
R5952:Mocos UTSW 18 24701387 missense possibly damaging 0.91
R5987:Mocos UTSW 18 24686693 missense probably damaging 1.00
R6173:Mocos UTSW 18 24676582 missense probably benign 0.03
R6209:Mocos UTSW 18 24666615 missense probably benign 0.41
R6376:Mocos UTSW 18 24701485 missense possibly damaging 0.50
R6416:Mocos UTSW 18 24701456 missense probably damaging 0.99
R6452:Mocos UTSW 18 24695941 missense probably benign 0.02
R6520:Mocos UTSW 18 24666390 missense probably benign 0.01
R6631:Mocos UTSW 18 24699931 missense probably benign 0.03
R6669:Mocos UTSW 18 24666410 missense probably damaging 0.98
R7114:Mocos UTSW 18 24666515 missense probably damaging 1.00
R7366:Mocos UTSW 18 24676616 missense probably damaging 1.00
R7690:Mocos UTSW 18 24664025 missense probably damaging 1.00
R7955:Mocos UTSW 18 24666159 missense probably damaging 1.00
R8458:Mocos UTSW 18 24666257 missense probably benign 0.00
R8762:Mocos UTSW 18 24679497 missense probably damaging 0.99
R9072:Mocos UTSW 18 24664032 missense probably damaging 0.98
R9073:Mocos UTSW 18 24664032 missense probably damaging 0.98
Z1176:Mocos UTSW 18 24670633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCTGACTGATTCTAGGCGGG -3'
(R):5'- GCAGCACAGGATTTGATGGG -3'

Sequencing Primer
(F):5'- ACTGATTCTAGGCGGGTCATGTC -3'
(R):5'- TGGTGACAATGTGGGACCC -3'
Posted On 2022-02-07