Incidental Mutation 'R9193:Myom1'
ID 697839
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9193 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71036300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: D164G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D164G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: D164G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D164G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179759
AA Change: D164G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D164G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,519 D284G probably benign Het
Ak1 A T 2: 32,630,379 K79M probably benign Het
Amy1 T C 3: 113,562,629 K293E probably benign Het
Bcl2l10 A G 9: 75,348,051 Q50R probably benign Het
Bpifa6 G A 2: 153,984,820 G35D probably benign Het
Cachd1 C A 4: 100,777,142 P5Q unknown Het
Capn13 A T 17: 73,345,196 I266N probably damaging Het
Ccdc144b G T 3: 36,035,279 N165K probably benign Het
Chil3 A G 3: 106,155,765 S170P possibly damaging Het
Ckap4 A G 10: 84,527,486 I571T probably damaging Het
Col14a1 A G 15: 55,379,568 M371V unknown Het
Dag1 A G 9: 108,208,268 L558P possibly damaging Het
Edem3 G A 1: 151,818,519 E868K probably benign Het
Eif3k T C 7: 28,974,199 Y150C probably damaging Het
Farp1 T C 14: 121,280,869 I988T probably benign Het
Fat3 A G 9: 15,998,952 M1918T probably benign Het
Gba2 A G 4: 43,578,112 I79T probably benign Het
Gbp8 T C 5: 105,031,303 D110G probably damaging Het
H2-Bl A G 17: 36,081,064 V39A possibly damaging Het
H2-M2 T A 17: 37,482,537 M193L probably benign Het
Ighv7-1 T A 12: 113,896,490 D94V probably damaging Het
Il2ra T C 2: 11,684,391 F244L possibly damaging Het
Jag1 A T 2: 137,089,844 H602Q probably null Het
Kidins220 A T 12: 24,986,967 I16F possibly damaging Het
Klb A G 5: 65,372,025 T299A possibly damaging Het
Lama4 A G 10: 39,075,448 K1063R probably benign Het
Lrit2 A G 14: 37,072,593 E538G possibly damaging Het
Lrrc7 A T 3: 158,353,374 L32* probably null Het
Lrrtm3 A T 10: 63,930,104 I568N probably damaging Het
Naaladl2 T C 3: 23,846,578 D696G probably damaging Het
Nalcn A T 14: 123,308,380 L1073* probably null Het
Nid2 T C 14: 19,803,210 S1166P probably damaging Het
Nlrp4c T C 7: 6,092,622 V833A probably benign Het
Nyap2 T C 1: 81,297,997 S619P probably damaging Het
Olfr1008 C A 2: 85,690,300 Y290* probably null Het
Olfr1243 A G 2: 89,527,643 Y256H probably damaging Het
Olfr434 A T 6: 43,217,152 T80S probably benign Het
Olfr976 T C 9: 39,956,582 M118V probably damaging Het
P3h2 T C 16: 26,105,241 N148S probably benign Het
P4htm A G 9: 108,582,882 M231T probably damaging Het
Pank1 T A 19: 34,827,234 K349I possibly damaging Het
Pgam5 A G 5: 110,265,600 Y210H probably benign Het
Prl2a1 T A 13: 27,808,552 C220S probably damaging Het
Prpmp5 T C 6: 132,312,033 H276R unknown Het
Psca C T 15: 74,716,083 Q39* probably null Het
Rgs20 A T 1: 5,020,844 M121K possibly damaging Het
S100z C T 13: 95,477,375 V76M possibly damaging Het
Sema4b CGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGC CGCTGCTGCTGCTGCTACTGCTGCTGCTGC 7: 80,198,690 probably benign Het
Slc30a10 T C 1: 185,462,837 I282T probably damaging Het
Slc30a3 T C 5: 31,088,744 Y214C probably damaging Het
Sox5 C T 6: 143,844,844 E497K probably benign Het
Sptbn1 C T 11: 30,137,551 E963K possibly damaging Het
Srl T C 16: 4,493,859 E465G possibly damaging Het
Tacc2 T C 7: 130,626,574 M1663T probably benign Het
Tas2r119 T G 15: 32,177,786 V166G probably benign Het
Tcf7l1 A G 6: 72,634,222 V191A probably damaging Het
Thap7 A T 16: 17,529,037 I92K probably damaging Het
Tnfsf10 A G 3: 27,317,258 T38A possibly damaging Het
Trav7-5 C G 14: 53,531,158 A61G probably benign Het
Trim30c C T 7: 104,382,346 V421I probably benign Het
Ugt2b38 A T 5: 87,423,870 M101K probably benign Het
Vmn1r44 T A 6: 89,893,583 C104S probably damaging Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp735 A T 11: 73,689,774 Y33F possibly damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
R8554:Myom1 UTSW 17 71036453 missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71106204 missense probably damaging 1.00
R8981:Myom1 UTSW 17 71084321 missense probably benign 0.09
R9012:Myom1 UTSW 17 71100108 missense probably benign 0.06
R9090:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9237:Myom1 UTSW 17 71101056 missense probably damaging 1.00
R9271:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9355:Myom1 UTSW 17 71077893 missense probably damaging 1.00
R9362:Myom1 UTSW 17 71036293 missense probably benign 0.00
R9440:Myom1 UTSW 17 71126334 missense probably benign 0.00
R9469:Myom1 UTSW 17 71061127 missense possibly damaging 0.79
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGAGACTTTGATTTACTAGGACGT -3'
(R):5'- CGAATTGCAATGTTCCTCGACT -3'

Sequencing Primer
(F):5'- TGTGAGTCAACACCTGGACG -3'
(R):5'- AATGTTCCTCGACTTCTTTTCAAACG -3'
Posted On 2022-02-07