Mutagenetix > Incidental Mutation

Incidental Mutation 'R9193:Myom1'

697839

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9193 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71036300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 164 (D164G)

Ref Sequence

ENSEMBL: ENSMUSP00000072945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

PDB Structure

Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024847
AA Change: D164G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D164G

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073211
AA Change: D164G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D164G

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179759
AA Change: D164G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D164G

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Meta Mutation Damage Score

0.1816

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,519	D284G	probably benign	Het
Ak1	A	T	2: 32,630,379	K79M	probably benign	Het
Amy1	T	C	3: 113,562,629	K293E	probably benign	Het
Bcl2l10	A	G	9: 75,348,051	Q50R	probably benign	Het
Bpifa6	G	A	2: 153,984,820	G35D	probably benign	Het
Cachd1	C	A	4: 100,777,142	P5Q	unknown	Het
Capn13	A	T	17: 73,345,196	I266N	probably damaging	Het
Ccdc144b	G	T	3: 36,035,279	N165K	probably benign	Het
Chil3	A	G	3: 106,155,765	S170P	possibly damaging	Het
Ckap4	A	G	10: 84,527,486	I571T	probably damaging	Het
Col14a1	A	G	15: 55,379,568	M371V	unknown	Het
Dag1	A	G	9: 108,208,268	L558P	possibly damaging	Het
Edem3	G	A	1: 151,818,519	E868K	probably benign	Het
Eif3k	T	C	7: 28,974,199	Y150C	probably damaging	Het
Farp1	T	C	14: 121,280,869	I988T	probably benign	Het
Fat3	A	G	9: 15,998,952	M1918T	probably benign	Het
Gba2	A	G	4: 43,578,112	I79T	probably benign	Het
Gbp8	T	C	5: 105,031,303	D110G	probably damaging	Het
H2-Bl	A	G	17: 36,081,064	V39A	possibly damaging	Het
H2-M2	T	A	17: 37,482,537	M193L	probably benign	Het
Ighv7-1	T	A	12: 113,896,490	D94V	probably damaging	Het
Il2ra	T	C	2: 11,684,391	F244L	possibly damaging	Het
Jag1	A	T	2: 137,089,844	H602Q	probably null	Het
Kidins220	A	T	12: 24,986,967	I16F	possibly damaging	Het
Klb	A	G	5: 65,372,025	T299A	possibly damaging	Het
Lama4	A	G	10: 39,075,448	K1063R	probably benign	Het
Lrit2	A	G	14: 37,072,593	E538G	possibly damaging	Het
Lrrc7	A	T	3: 158,353,374	L32*	probably null	Het
Lrrtm3	A	T	10: 63,930,104	I568N	probably damaging	Het
Naaladl2	T	C	3: 23,846,578	D696G	probably damaging	Het
Nalcn	A	T	14: 123,308,380	L1073*	probably null	Het
Nid2	T	C	14: 19,803,210	S1166P	probably damaging	Het
Nlrp4c	T	C	7: 6,092,622	V833A	probably benign	Het
Nyap2	T	C	1: 81,297,997	S619P	probably damaging	Het
Olfr1008	C	A	2: 85,690,300	Y290*	probably null	Het
Olfr1243	A	G	2: 89,527,643	Y256H	probably damaging	Het
Olfr434	A	T	6: 43,217,152	T80S	probably benign	Het
Olfr976	T	C	9: 39,956,582	M118V	probably damaging	Het
P3h2	T	C	16: 26,105,241	N148S	probably benign	Het
P4htm	A	G	9: 108,582,882	M231T	probably damaging	Het
Pank1	T	A	19: 34,827,234	K349I	possibly damaging	Het
Pgam5	A	G	5: 110,265,600	Y210H	probably benign	Het
Prl2a1	T	A	13: 27,808,552	C220S	probably damaging	Het
Prpmp5	T	C	6: 132,312,033	H276R	unknown	Het
Psca	C	T	15: 74,716,083	Q39*	probably null	Het
Rgs20	A	T	1: 5,020,844	M121K	possibly damaging	Het
S100z	C	T	13: 95,477,375	V76M	possibly damaging	Het
Slc30a10	T	C	1: 185,462,837	I282T	probably damaging	Het
Slc30a3	T	C	5: 31,088,744	Y214C	probably damaging	Het
Sox5	C	T	6: 143,844,844	E497K	probably benign	Het
Sptbn1	C	T	11: 30,137,551	E963K	possibly damaging	Het
Srl	T	C	16: 4,493,859	E465G	possibly damaging	Het
Tacc2	T	C	7: 130,626,574	M1663T	probably benign	Het
Tas2r119	T	G	15: 32,177,786	V166G	probably benign	Het
Tcf7l1	A	G	6: 72,634,222	V191A	probably damaging	Het
Thap7	A	T	16: 17,529,037	I92K	probably damaging	Het
Tnfsf10	A	G	3: 27,317,258	T38A	possibly damaging	Het
Trav7-5	C	G	14: 53,531,158	A61G	probably benign	Het
Trim30c	C	T	7: 104,382,346	V421I	probably benign	Het
Ugt2b38	A	T	5: 87,423,870	M101K	probably benign	Het
Vmn1r44	T	A	6: 89,893,583	C104S	probably damaging	Het
Wdr74	T	A	19: 8,737,876	V133E	probably damaging	Het
Zfp735	A	T	11: 73,689,774	Y33F	possibly damaging	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- AGAGACTTTGATTTACTAGGACGT -3'
(R):5'- CGAATTGCAATGTTCCTCGACT -3'

Sequencing Primer
(F):5'- TGTGAGTCAACACCTGGACG -3'
(R):5'- AATGTTCCTCGACTTCTTTTCAAACG -3'

Posted On

2022-02-07