Mutagenetix > Incidental Mutation

Incidental Mutation 'R9194:Ubr1'

697846

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

068953-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R9194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120947844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 238 (Y238H)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably damaging
Transcript: ENSMUST00000028728
AA Change: Y238H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: Y238H

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Meta Mutation Damage Score

0.6541

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,259,088 (GRCm38)	M1K	probably null	Het
Adra1b	A	T	11: 43,835,436 (GRCm38)	V218D	probably damaging	Het
Ank1	A	G	8: 23,116,239 (GRCm38)	S1216G	possibly damaging	Het
Celsr1	G	T	15: 86,033,085 (GRCm38)	S229*	probably null	Het
Cfap44	G	T	16: 44,468,461 (GRCm38)	D1525Y	probably damaging	Het
Chd8	A	T	14: 52,202,193 (GRCm38)	M2341K	probably benign	Het
Chst11	A	G	10: 83,191,485 (GRCm38)	T249A	probably damaging	Het
Cttnbp2	A	G	6: 18,434,851 (GRCm38)	V336A	probably benign	Het
Dennd3	T	C	15: 73,547,304 (GRCm38)	L648P	probably benign	Het
Dgcr14	A	T	16: 17,910,164 (GRCm38)	D79E	probably damaging	Het
Dhx16	T	C	17: 35,889,281 (GRCm38)	V864A	probably benign	Het
Enpp3	G	A	10: 24,799,194 (GRCm38)	H362Y	possibly damaging	Het
Fam83c	T	A	2: 155,829,379 (GRCm38)	Y712F	probably damaging	Het
Helz	C	T	11: 107,670,287 (GRCm38)	Q1392*	probably null	Het
Il18rap	C	T	1: 40,543,017 (GRCm38)	T366M	probably benign	Het
Iqch	T	C	9: 63,572,679 (GRCm38)	H143R	probably benign	Het
Itgb5	A	G	16: 33,900,511 (GRCm38)	D315G	probably damaging	Het
Kcnmb2	A	G	3: 32,182,025 (GRCm38)	K141R	probably benign	Het
Lrrc37a	G	A	11: 103,500,850 (GRCm38)	P1250S	probably benign	Het
Mcm5	T	G	8: 75,110,334 (GRCm38)	V110G	probably damaging	Het
Med27	G	A	2: 29,471,300 (GRCm38)	D163N	probably damaging	Het
Mms22l	C	A	4: 24,600,185 (GRCm38)	Y1129*	probably null	Het
Mov10l1	G	A	15: 89,046,820 (GRCm38)	R1081H	probably damaging	Het
Mtpap	C	G	18: 4,380,833 (GRCm38)	N170K	probably benign	Het
Mtpap	C	T	18: 4,380,834 (GRCm38)	Q171*	probably null	Het
Myo6	T	A	9: 80,246,554 (GRCm38)	F271I	unknown	Het
Ndst4	C	T	3: 125,724,736 (GRCm38)	S354L	probably benign	Het
Nfatc1	C	T	18: 80,708,043 (GRCm38)	A26T	probably benign	Het
Olfr867	C	A	9: 20,055,247 (GRCm38)	C72F	probably damaging	Het
Piezo2	G	C	18: 63,117,744 (GRCm38)	T428S	probably benign	Het
Prkch	A	G	12: 73,721,842 (GRCm38)	E462G	probably damaging	Het
Rbm20	A	G	19: 53,834,700 (GRCm38)	Y576C	probably damaging	Het
Riok3	TTTCATT	TTT	18: 12,149,585 (GRCm38)		probably null	Het
Rpp40	C	T	13: 35,896,915 (GRCm38)	D302N	probably benign	Het
Sash1	A	G	10: 8,740,205 (GRCm38)	V631A	probably damaging	Het
Sstr2	A	G	11: 113,624,377 (GRCm38)	T41A	probably benign	Het
Thsd7b	T	A	1: 129,915,634 (GRCm38)	V861E	possibly damaging	Het
Tomm70a	A	G	16: 57,152,707 (GRCm38)	K603E	possibly damaging	Het
Tpd52l2	T	A	2: 181,499,890 (GRCm38)	M22K	possibly damaging	Het
Tpst1	T	A	5: 130,102,019 (GRCm38)	L110Q	possibly damaging	Het
Tram1l1	A	G	3: 124,321,488 (GRCm38)	Y99C	possibly damaging	Het
Ttc39b	A	G	4: 83,263,740 (GRCm38)	F81L	possibly damaging	Het
Vmn1r202	G	T	13: 22,502,146 (GRCm38)	H34N	possibly damaging	Het
Vmn1r36	G	A	6: 66,716,052 (GRCm38)	Q280*	probably null	Het
Xpnpep1	A	T	19: 53,011,858 (GRCm38)	V187E	possibly damaging	Het
Zfp592	A	G	7: 81,024,601 (GRCm38)	I438V	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,875,407 (GRCm38)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,941,093 (GRCm38)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,930,872 (GRCm38)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,914,905 (GRCm38)	missense	probably benign
IGL01346:Ubr1	APN	2	120,873,122 (GRCm38)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,941,131 (GRCm38)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,926,013 (GRCm38)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,934,342 (GRCm38)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,875,398 (GRCm38)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,921,386 (GRCm38)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,900,508 (GRCm38)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,946,349 (GRCm38)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,970,603 (GRCm38)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,864,373 (GRCm38)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,870,979 (GRCm38)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,940,991 (GRCm38)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,914,883 (GRCm38)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,941,091 (GRCm38)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,881,183 (GRCm38)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,961,156 (GRCm38)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,864,417 (GRCm38)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,895,160 (GRCm38)	missense	probably benign
I1329:Ubr1	UTSW	2	120,934,294 (GRCm38)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,961,173 (GRCm38)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,904,103 (GRCm38)	splice site	probably null
R0373:Ubr1	UTSW	2	120,946,657 (GRCm38)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,906,946 (GRCm38)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,881,093 (GRCm38)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,947,883 (GRCm38)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,881,101 (GRCm38)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,926,029 (GRCm38)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,955,644 (GRCm38)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,961,098 (GRCm38)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,935,319 (GRCm38)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,930,968 (GRCm38)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,930,968 (GRCm38)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,946,273 (GRCm38)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,942,553 (GRCm38)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,864,330 (GRCm38)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,926,047 (GRCm38)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,909,482 (GRCm38)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,963,448 (GRCm38)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,916,470 (GRCm38)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,862,687 (GRCm38)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,946,622 (GRCm38)	splice site	probably null
R4173:Ubr1	UTSW	2	120,946,622 (GRCm38)	splice site	probably null
R4174:Ubr1	UTSW	2	120,946,622 (GRCm38)	splice site	probably null
R4241:Ubr1	UTSW	2	120,934,386 (GRCm38)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,970,603 (GRCm38)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,895,066 (GRCm38)	splice site	probably null
R4449:Ubr1	UTSW	2	120,946,381 (GRCm38)	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120,942,482 (GRCm38)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,926,013 (GRCm38)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,963,442 (GRCm38)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,914,938 (GRCm38)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,963,566 (GRCm38)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,911,997 (GRCm38)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,963,422 (GRCm38)	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120,882,264 (GRCm38)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,893,170 (GRCm38)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,904,044 (GRCm38)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,963,500 (GRCm38)	missense	probably benign
R5452:Ubr1	UTSW	2	120,868,302 (GRCm38)	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120,915,407 (GRCm38)	missense	probably benign
R5610:Ubr1	UTSW	2	120,892,112 (GRCm38)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,963,517 (GRCm38)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,961,092 (GRCm38)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,904,005 (GRCm38)	missense	probably benign
R5979:Ubr1	UTSW	2	120,946,382 (GRCm38)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,862,721 (GRCm38)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,893,209 (GRCm38)	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120,906,895 (GRCm38)	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120,881,039 (GRCm38)	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120,915,399 (GRCm38)	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120,924,130 (GRCm38)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,955,640 (GRCm38)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,896,675 (GRCm38)	splice site	probably null
R6994:Ubr1	UTSW	2	120,963,593 (GRCm38)	missense	probably benign
R7121:Ubr1	UTSW	2	120,875,498 (GRCm38)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,904,077 (GRCm38)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,862,765 (GRCm38)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,862,680 (GRCm38)	missense	probably benign
R7457:Ubr1	UTSW	2	120,917,828 (GRCm38)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,889,774 (GRCm38)	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120,875,444 (GRCm38)	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120,873,191 (GRCm38)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,934,374 (GRCm38)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,934,417 (GRCm38)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,961,104 (GRCm38)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,963,456 (GRCm38)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,911,115 (GRCm38)	missense	probably benign
R8293:Ubr1	UTSW	2	120,862,721 (GRCm38)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,870,995 (GRCm38)	missense	probably benign
R8489:Ubr1	UTSW	2	120,881,067 (GRCm38)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,866,483 (GRCm38)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,904,042 (GRCm38)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,866,553 (GRCm38)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,925,988 (GRCm38)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,924,134 (GRCm38)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,873,122 (GRCm38)	critical splice donor site	probably null
R9320:Ubr1	UTSW	2	120,896,519 (GRCm38)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,935,284 (GRCm38)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,904,025 (GRCm38)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,873,146 (GRCm38)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,934,339 (GRCm38)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,901,611 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCAGCTAAACCAATAAGGC -3'
(R):5'- TCATGTCCTGGATCAATATCACAATG -3'

Sequencing Primer
(F):5'- TGCTCAGGTAATCACAGTTGC -3'
(R):5'- CACAATGTTATTTCCCTAGAGATAGG -3'

Posted On

2022-02-07