Mutagenetix > Incidental Mutation

Incidental Mutation 'R9194:Mms22l'

697852

Institutional Source

Beutler Lab

Gene Symbol

Mms22l

Ensembl Gene

ENSMUSG00000045751

Gene Name

MMS22-like, DNA repair protein

Synonyms

F730047E07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24496451-24602950 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 24600185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1129 (Y1129*)

Ref Sequence

ENSEMBL: ENSMUSP00000057715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222]

AlphaFold

B1AUR6

Predicted Effect

probably null
Transcript: ENSMUST00000050446
AA Change: Y1129*

SMART Domains

Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: Y1129*

Domain	Start	End	E-Value	Type
Pfam:MMS22L_N	26	395	1.1e-199	PFAM
Pfam:MMS22L_N	392	690	4.6e-155	PFAM
low complexity region	698	711	N/A	INTRINSIC
low complexity region	761	770	N/A	INTRINSIC
Pfam:MMS22L_C	809	1186	2.3e-133	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108222
AA Change: Y1169*

SMART Domains

Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: Y1169*

Domain	Start	End	E-Value	Type
Pfam:MMS22L_N	26	730	N/A	PFAM
low complexity region	738	751	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
Pfam:MMS22L_C	849	1225	1.4e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131282

SMART Domains

Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751

Domain	Start	End	E-Value	Type
Pfam:MMS22L_N	1	459	1.3e-239	PFAM
low complexity region	467	480	N/A	INTRINSIC
low complexity region	530	539	N/A	INTRINSIC
Pfam:MMS22L_C	578	733	1.9e-58	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,259,088	M1K	probably null	Het
Adra1b	A	T	11: 43,835,436	V218D	probably damaging	Het
Ank1	A	G	8: 23,116,239	S1216G	possibly damaging	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cfap44	G	T	16: 44,468,461	D1525Y	probably damaging	Het
Chd8	A	T	14: 52,202,193	M2341K	probably benign	Het
Chst11	A	G	10: 83,191,485	T249A	probably damaging	Het
Cttnbp2	A	G	6: 18,434,851	V336A	probably benign	Het
Dennd3	T	C	15: 73,547,304	L648P	probably benign	Het
Dgcr14	A	T	16: 17,910,164	D79E	probably damaging	Het
Dhx16	T	C	17: 35,889,281	V864A	probably benign	Het
Enpp3	G	A	10: 24,799,194	H362Y	possibly damaging	Het
Fam83c	T	A	2: 155,829,379	Y712F	probably damaging	Het
Helz	C	T	11: 107,670,287	Q1392*	probably null	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Iqch	T	C	9: 63,572,679	H143R	probably benign	Het
Itgb5	A	G	16: 33,900,511	D315G	probably damaging	Het
Kcnmb2	A	G	3: 32,182,025	K141R	probably benign	Het
Lrrc37a	G	A	11: 103,500,850	P1250S	probably benign	Het
Mcm5	T	G	8: 75,110,334	V110G	probably damaging	Het
Med27	G	A	2: 29,471,300	D163N	probably damaging	Het
Mov10l1	G	A	15: 89,046,820	R1081H	probably damaging	Het
Mtpap	C	G	18: 4,380,833	N170K	probably benign	Het
Mtpap	C	T	18: 4,380,834	Q171*	probably null	Het
Myo6	T	A	9: 80,246,554	F271I	unknown	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nfatc1	C	T	18: 80,708,043	A26T	probably benign	Het
Olfr867	C	A	9: 20,055,247	C72F	probably damaging	Het
Piezo2	G	C	18: 63,117,744	T428S	probably benign	Het
Prkch	A	G	12: 73,721,842	E462G	probably damaging	Het
Rbm20	A	G	19: 53,834,700	Y576C	probably damaging	Het
Riok3	TTTCATT	TTT	18: 12,149,585		probably null	Het
Rpp40	C	T	13: 35,896,915	D302N	probably benign	Het
Sash1	A	G	10: 8,740,205	V631A	probably damaging	Het
Sstr2	A	G	11: 113,624,377	T41A	probably benign	Het
Thsd7b	T	A	1: 129,915,634	V861E	possibly damaging	Het
Tomm70a	A	G	16: 57,152,707	K603E	possibly damaging	Het
Tpd52l2	T	A	2: 181,499,890	M22K	possibly damaging	Het
Tpst1	T	A	5: 130,102,019	L110Q	possibly damaging	Het
Tram1l1	A	G	3: 124,321,488	Y99C	possibly damaging	Het
Ttc39b	A	G	4: 83,263,740	F81L	possibly damaging	Het
Ubr1	A	G	2: 120,947,844	Y238H	probably damaging	Het
Vmn1r202	G	T	13: 22,502,146	H34N	possibly damaging	Het
Vmn1r36	G	A	6: 66,716,052	Q280*	probably null	Het
Xpnpep1	A	T	19: 53,011,858	V187E	possibly damaging	Het
Zfp592	A	G	7: 81,024,601	I438V	probably benign	Het

Other mutations in Mms22l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01648:Mms22l	APN	4	24502805	missense	probably damaging	1.00
IGL02158:Mms22l	APN	4	24505349	missense	probably damaging	0.98
IGL02533:Mms22l	APN	4	24581099	splice site	probably benign
IGL02612:Mms22l	APN	4	24508482	missense	probably benign	0.03
IGL02685:Mms22l	APN	4	24591133	missense	probably benign
IGL03000:Mms22l	APN	4	24581161	missense	probably damaging	0.99
IGL03006:Mms22l	APN	4	24521253	missense	probably damaging	1.00
PIT4280001:Mms22l	UTSW	4	24581149	missense	probably benign	0.08
R0157:Mms22l	UTSW	4	24588224	missense	probably damaging	1.00
R0279:Mms22l	UTSW	4	24497867	missense	probably damaging	1.00
R0669:Mms22l	UTSW	4	24517223	missense	probably benign	0.00
R1056:Mms22l	UTSW	4	24586344	critical splice donor site	probably null
R1232:Mms22l	UTSW	4	24536274	missense	probably benign	0.24
R1389:Mms22l	UTSW	4	24591076	missense	probably damaging	1.00
R1543:Mms22l	UTSW	4	24591084	missense	probably benign	0.41
R1604:Mms22l	UTSW	4	24502804	missense	probably damaging	1.00
R1872:Mms22l	UTSW	4	24598807	missense	probably damaging	0.99
R1929:Mms22l	UTSW	4	24535936	unclassified	probably benign
R2024:Mms22l	UTSW	4	24588365	missense	probably damaging	1.00
R2081:Mms22l	UTSW	4	24536150	missense	probably damaging	1.00
R2104:Mms22l	UTSW	4	24591084	missense	probably benign	0.41
R2147:Mms22l	UTSW	4	24580063	nonsense	probably null
R2379:Mms22l	UTSW	4	24496929	missense	possibly damaging	0.87
R2496:Mms22l	UTSW	4	24521269	missense	probably benign	0.31
R3508:Mms22l	UTSW	4	24586224	missense	probably benign	0.01
R3625:Mms22l	UTSW	4	24505357	missense	probably damaging	1.00
R3789:Mms22l	UTSW	4	24517115	missense	possibly damaging	0.75
R4422:Mms22l	UTSW	4	24503008	missense	probably damaging	1.00
R4623:Mms22l	UTSW	4	24502792	nonsense	probably null
R4799:Mms22l	UTSW	4	24580052	critical splice acceptor site	probably null
R4825:Mms22l	UTSW	4	24536226	missense	probably damaging	1.00
R5236:Mms22l	UTSW	4	24588347	missense	probably benign	0.02
R5276:Mms22l	UTSW	4	24578774	missense	probably damaging	1.00
R5364:Mms22l	UTSW	4	24496882	unclassified	probably benign
R5394:Mms22l	UTSW	4	24517115	missense	possibly damaging	0.75
R6905:Mms22l	UTSW	4	24503107	missense	probably benign	0.00
R7206:Mms22l	UTSW	4	24591146	missense	probably benign	0.00
R7290:Mms22l	UTSW	4	24517139	missense	probably benign
R7425:Mms22l	UTSW	4	24596287	missense	probably benign	0.15
R7524:Mms22l	UTSW	4	24536138	missense	possibly damaging	0.89
R7536:Mms22l	UTSW	4	24581240	missense	probably damaging	0.99
R7722:Mms22l	UTSW	4	24517201	missense	probably damaging	1.00
R7757:Mms22l	UTSW	4	24598884	critical splice donor site	probably null
R7764:Mms22l	UTSW	4	24598842	missense	probably damaging	1.00
R7947:Mms22l	UTSW	4	24505373	missense	probably damaging	1.00
R8220:Mms22l	UTSW	4	24536375	missense	probably damaging	1.00
R8316:Mms22l	UTSW	4	24578855	missense	probably damaging	0.98
R8472:Mms22l	UTSW	4	24502943	missense	possibly damaging	0.86
R8495:Mms22l	UTSW	4	24496908	start codon destroyed	probably null	0.96
R8699:Mms22l	UTSW	4	24507363	missense	possibly damaging	0.72
R8795:Mms22l	UTSW	4	24536245	missense	probably benign	0.21
R8932:Mms22l	UTSW	4	24533029	missense	probably damaging	1.00
R8979:Mms22l	UTSW	4	24580070	missense	probably benign	0.01
R8996:Mms22l	UTSW	4	24598884	critical splice donor site	probably null
R9184:Mms22l	UTSW	4	24596182	missense	probably damaging	1.00
R9204:Mms22l	UTSW	4	24581153	missense	probably damaging	1.00
R9258:Mms22l	UTSW	4	24588238	missense	probably damaging	1.00
R9266:Mms22l	UTSW	4	24578878	missense	probably damaging	1.00
R9403:Mms22l	UTSW	4	24580204	critical splice donor site	probably null
R9788:Mms22l	UTSW	4	24586204	missense	probably benign	0.08
RF005:Mms22l	UTSW	4	24517207	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TGTGAGGCACCTGATTCACC -3'
(R):5'- ACAACAGTTACAGCATTGAAGC -3'

Sequencing Primer
(F):5'- CGGTAATCCCAGCATTCTAAGTGG -3'
(R):5'- CAGTTACAGCATTGAAGCACTTTTC -3'

Posted On

2022-02-07