Incidental Mutation 'R9194:Olfr867'
ID 697860
Institutional Source Beutler Lab
Gene Symbol Olfr867
Ensembl Gene ENSMUSG00000044454
Gene Name olfactory receptor 867
Synonyms MOR143-2, GA_x6K02T2PVTD-13795933-13794938
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9194 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 20050955-20057562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20055247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 72 (C72F)
Ref Sequence ENSEMBL: ENSMUSP00000150378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060780] [ENSMUST00000212098] [ENSMUST00000216538]
AlphaFold Q7TRF3
Predicted Effect probably damaging
Transcript: ENSMUST00000060780
AA Change: C72F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057469
Gene: ENSMUSG00000044454
AA Change: C72F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 301 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212098
Predicted Effect probably damaging
Transcript: ENSMUST00000216538
AA Change: C72F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,259,088 M1K probably null Het
Adra1b A T 11: 43,835,436 V218D probably damaging Het
Ank1 A G 8: 23,116,239 S1216G possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cfap44 G T 16: 44,468,461 D1525Y probably damaging Het
Chd8 A T 14: 52,202,193 M2341K probably benign Het
Chst11 A G 10: 83,191,485 T249A probably damaging Het
Cttnbp2 A G 6: 18,434,851 V336A probably benign Het
Dennd3 T C 15: 73,547,304 L648P probably benign Het
Dgcr14 A T 16: 17,910,164 D79E probably damaging Het
Dhx16 T C 17: 35,889,281 V864A probably benign Het
Enpp3 G A 10: 24,799,194 H362Y possibly damaging Het
Fam83c T A 2: 155,829,379 Y712F probably damaging Het
Helz C T 11: 107,670,287 Q1392* probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Iqch T C 9: 63,572,679 H143R probably benign Het
Itgb5 A G 16: 33,900,511 D315G probably damaging Het
Kcnmb2 A G 3: 32,182,025 K141R probably benign Het
Lrrc37a G A 11: 103,500,850 P1250S probably benign Het
Mcm5 T G 8: 75,110,334 V110G probably damaging Het
Med27 G A 2: 29,471,300 D163N probably damaging Het
Mms22l C A 4: 24,600,185 Y1129* probably null Het
Mov10l1 G A 15: 89,046,820 R1081H probably damaging Het
Mtpap C G 18: 4,380,833 N170K probably benign Het
Mtpap C T 18: 4,380,834 Q171* probably null Het
Myo6 T A 9: 80,246,554 F271I unknown Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nfatc1 C T 18: 80,708,043 A26T probably benign Het
Piezo2 G C 18: 63,117,744 T428S probably benign Het
Prkch A G 12: 73,721,842 E462G probably damaging Het
Rbm20 A G 19: 53,834,700 Y576C probably damaging Het
Riok3 TTTCATT TTT 18: 12,149,585 probably null Het
Rpp40 C T 13: 35,896,915 D302N probably benign Het
Sash1 A G 10: 8,740,205 V631A probably damaging Het
Sstr2 A G 11: 113,624,377 T41A probably benign Het
Thsd7b T A 1: 129,915,634 V861E possibly damaging Het
Tomm70a A G 16: 57,152,707 K603E possibly damaging Het
Tpd52l2 T A 2: 181,499,890 M22K possibly damaging Het
Tpst1 T A 5: 130,102,019 L110Q possibly damaging Het
Tram1l1 A G 3: 124,321,488 Y99C possibly damaging Het
Ttc39b A G 4: 83,263,740 F81L possibly damaging Het
Ubr1 A G 2: 120,947,844 Y238H probably damaging Het
Vmn1r202 G T 13: 22,502,146 H34N possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Xpnpep1 A T 19: 53,011,858 V187E possibly damaging Het
Zfp592 A G 7: 81,024,601 I438V probably benign Het
Other mutations in Olfr867
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Olfr867 APN 9 20054900 missense probably benign 0.01
IGL03130:Olfr867 APN 9 20055372 missense probably benign 0.34
R1034:Olfr867 UTSW 9 20055365 missense probably benign 0.02
R1238:Olfr867 UTSW 9 20055461 start codon destroyed probably benign 0.12
R1412:Olfr867 UTSW 9 20055415 missense possibly damaging 0.65
R1625:Olfr867 UTSW 9 20055382 missense probably damaging 1.00
R1689:Olfr867 UTSW 9 20055126 missense possibly damaging 0.94
R2060:Olfr867 UTSW 9 20054596 missense probably damaging 1.00
R2204:Olfr867 UTSW 9 20055211 missense possibly damaging 0.74
R2350:Olfr867 UTSW 9 20055088 missense probably damaging 1.00
R3901:Olfr867 UTSW 9 20054873 missense probably benign 0.00
R5637:Olfr867 UTSW 9 20054983 missense possibly damaging 0.80
R6084:Olfr867 UTSW 9 20054883 missense possibly damaging 0.71
R6150:Olfr867 UTSW 9 20054874 missense probably benign 0.22
R6602:Olfr867 UTSW 9 20055046 missense probably benign 0.01
R6902:Olfr867 UTSW 9 20055374 missense possibly damaging 0.47
R6946:Olfr867 UTSW 9 20055374 missense possibly damaging 0.47
R7085:Olfr867 UTSW 9 20054936 missense probably benign 0.37
R7678:Olfr867 UTSW 9 20054605 missense probably damaging 1.00
R8034:Olfr867 UTSW 9 20055005 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGAATCAGAAGTGCACACAGTC -3'
(R):5'- ATCCTGGGTCTCTCTGATGAC -3'

Sequencing Primer
(F):5'- CACAGTCGAGGGTTCATAATAAC -3'
(R):5'- TCTGATGACCCTGAATTGCAAC -3'
Posted On 2022-02-07