Incidental Mutation 'R9194:Enpp3'
ID 697865
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 068953-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9194 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24675092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 362 (H362Y)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000020169
AA Change: H362Y

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: H362Y

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,166,371 (GRCm39) M1K probably null Het
Adra1b A T 11: 43,726,263 (GRCm39) V218D probably damaging Het
Ank1 A G 8: 23,606,255 (GRCm39) S1216G possibly damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cfap44 G T 16: 44,288,824 (GRCm39) D1525Y probably damaging Het
Chd8 A T 14: 52,439,650 (GRCm39) M2341K probably benign Het
Chst11 A G 10: 83,027,319 (GRCm39) T249A probably damaging Het
Cttnbp2 A G 6: 18,434,850 (GRCm39) V336A probably benign Het
Dennd3 T C 15: 73,419,153 (GRCm39) L648P probably benign Het
Dhx16 T C 17: 36,200,173 (GRCm39) V864A probably benign Het
Ess2 A T 16: 17,728,028 (GRCm39) D79E probably damaging Het
Fam83c T A 2: 155,671,299 (GRCm39) Y712F probably damaging Het
Helz C T 11: 107,561,113 (GRCm39) Q1392* probably null Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Iqch T C 9: 63,479,961 (GRCm39) H143R probably benign Het
Itgb5 A G 16: 33,720,881 (GRCm39) D315G probably damaging Het
Kcnmb2 A G 3: 32,236,174 (GRCm39) K141R probably benign Het
Lrrc37a G A 11: 103,391,676 (GRCm39) P1250S probably benign Het
Mcm5 T G 8: 75,836,962 (GRCm39) V110G probably damaging Het
Med27 G A 2: 29,361,312 (GRCm39) D163N probably damaging Het
Mms22l C A 4: 24,600,185 (GRCm39) Y1129* probably null Het
Mov10l1 G A 15: 88,931,023 (GRCm39) R1081H probably damaging Het
Mtpap C T 18: 4,380,834 (GRCm39) Q171* probably null Het
Mtpap C G 18: 4,380,833 (GRCm39) N170K probably benign Het
Myo6 T A 9: 80,153,836 (GRCm39) F271I unknown Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nfatc1 C T 18: 80,751,258 (GRCm39) A26T probably benign Het
Or7d11 C A 9: 19,966,543 (GRCm39) C72F probably damaging Het
Piezo2 G C 18: 63,250,815 (GRCm39) T428S probably benign Het
Prkch A G 12: 73,768,616 (GRCm39) E462G probably damaging Het
Rbm20 A G 19: 53,823,131 (GRCm39) Y576C probably damaging Het
Riok3 TTTCATT TTT 18: 12,282,642 (GRCm39) probably null Het
Rpp40 C T 13: 36,080,898 (GRCm39) D302N probably benign Het
Sash1 A G 10: 8,615,969 (GRCm39) V631A probably damaging Het
Sstr2 A G 11: 113,515,203 (GRCm39) T41A probably benign Het
Thsd7b T A 1: 129,843,371 (GRCm39) V861E possibly damaging Het
Tomm70a A G 16: 56,973,070 (GRCm39) K603E possibly damaging Het
Tpd52l2 T A 2: 181,141,683 (GRCm39) M22K possibly damaging Het
Tpst1 T A 5: 130,130,860 (GRCm39) L110Q possibly damaging Het
Tram1l1 A G 3: 124,115,137 (GRCm39) Y99C possibly damaging Het
Ttc39b A G 4: 83,181,977 (GRCm39) F81L possibly damaging Het
Ubr1 A G 2: 120,778,325 (GRCm39) Y238H probably damaging Het
Vmn1r202 G T 13: 22,686,316 (GRCm39) H34N possibly damaging Het
Vmn1r36 G A 6: 66,693,036 (GRCm39) Q280* probably null Het
Xpnpep1 A T 19: 53,000,289 (GRCm39) V187E possibly damaging Het
Zfp592 A G 7: 80,674,349 (GRCm39) I438V probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACGTGGACAGATATTCAGGAC -3'
(R):5'- ACCATGGCTGTGTAGTATGAATGG -3'

Sequencing Primer
(F):5'- TTAAAGTGGAAACTTTAGACCCCC -3'
(R):5'- ATGGCTGTGTAGTATGAATGGTTGAC -3'
Posted On 2022-02-07