Mutagenetix > Incidental Mutation

Incidental Mutation 'R9194:Enpp3'

697865

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R9194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24799194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 362 (H362Y)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020169
AA Change: H362Y

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: H362Y

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,259,088	M1K	probably null	Het
Adra1b	A	T	11: 43,835,436	V218D	probably damaging	Het
Ank1	A	G	8: 23,116,239	S1216G	possibly damaging	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cfap44	G	T	16: 44,468,461	D1525Y	probably damaging	Het
Chd8	A	T	14: 52,202,193	M2341K	probably benign	Het
Chst11	A	G	10: 83,191,485	T249A	probably damaging	Het
Cttnbp2	A	G	6: 18,434,851	V336A	probably benign	Het
Dennd3	T	C	15: 73,547,304	L648P	probably benign	Het
Dgcr14	A	T	16: 17,910,164	D79E	probably damaging	Het
Dhx16	T	C	17: 35,889,281	V864A	probably benign	Het
Fam83c	T	A	2: 155,829,379	Y712F	probably damaging	Het
Helz	C	T	11: 107,670,287	Q1392*	probably null	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Iqch	T	C	9: 63,572,679	H143R	probably benign	Het
Itgb5	A	G	16: 33,900,511	D315G	probably damaging	Het
Kcnmb2	A	G	3: 32,182,025	K141R	probably benign	Het
Lrrc37a	G	A	11: 103,500,850	P1250S	probably benign	Het
Mcm5	T	G	8: 75,110,334	V110G	probably damaging	Het
Med27	G	A	2: 29,471,300	D163N	probably damaging	Het
Mms22l	C	A	4: 24,600,185	Y1129*	probably null	Het
Mov10l1	G	A	15: 89,046,820	R1081H	probably damaging	Het
Mtpap	C	G	18: 4,380,833	N170K	probably benign	Het
Mtpap	C	T	18: 4,380,834	Q171*	probably null	Het
Myo6	T	A	9: 80,246,554	F271I	unknown	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nfatc1	C	T	18: 80,708,043	A26T	probably benign	Het
Olfr867	C	A	9: 20,055,247	C72F	probably damaging	Het
Piezo2	G	C	18: 63,117,744	T428S	probably benign	Het
Prkch	A	G	12: 73,721,842	E462G	probably damaging	Het
Rbm20	A	G	19: 53,834,700	Y576C	probably damaging	Het
Riok3	TTTCATT	TTT	18: 12,149,585		probably null	Het
Rpp40	C	T	13: 35,896,915	D302N	probably benign	Het
Sash1	A	G	10: 8,740,205	V631A	probably damaging	Het
Sstr2	A	G	11: 113,624,377	T41A	probably benign	Het
Thsd7b	T	A	1: 129,915,634	V861E	possibly damaging	Het
Tomm70a	A	G	16: 57,152,707	K603E	possibly damaging	Het
Tpd52l2	T	A	2: 181,499,890	M22K	possibly damaging	Het
Tpst1	T	A	5: 130,102,019	L110Q	possibly damaging	Het
Tram1l1	A	G	3: 124,321,488	Y99C	possibly damaging	Het
Ttc39b	A	G	4: 83,263,740	F81L	possibly damaging	Het
Ubr1	A	G	2: 120,947,844	Y238H	probably damaging	Het
Vmn1r202	G	T	13: 22,502,146	H34N	possibly damaging	Het
Vmn1r36	G	A	6: 66,716,052	Q280*	probably null	Het
Xpnpep1	A	T	19: 53,011,858	V187E	possibly damaging	Het
Zfp592	A	G	7: 81,024,601	I438V	probably benign	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCACGTGGACAGATATTCAGGAC -3'
(R):5'- ACCATGGCTGTGTAGTATGAATGG -3'

Sequencing Primer
(F):5'- TTAAAGTGGAAACTTTAGACCCCC -3'
(R):5'- ATGGCTGTGTAGTATGAATGGTTGAC -3'

Posted On

2022-02-07