Incidental Mutation 'R9194:Lrrc37a'
ID 697868
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Name leucine rich repeat containing 37A
Synonyms LOC237954
MMRRC Submission 068953-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9194 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 103341535-103395423 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103391676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1250 (P1250S)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: P1250S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: P1250S

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,166,371 (GRCm39) M1K probably null Het
Adra1b A T 11: 43,726,263 (GRCm39) V218D probably damaging Het
Ank1 A G 8: 23,606,255 (GRCm39) S1216G possibly damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cfap44 G T 16: 44,288,824 (GRCm39) D1525Y probably damaging Het
Chd8 A T 14: 52,439,650 (GRCm39) M2341K probably benign Het
Chst11 A G 10: 83,027,319 (GRCm39) T249A probably damaging Het
Cttnbp2 A G 6: 18,434,850 (GRCm39) V336A probably benign Het
Dennd3 T C 15: 73,419,153 (GRCm39) L648P probably benign Het
Dhx16 T C 17: 36,200,173 (GRCm39) V864A probably benign Het
Enpp3 G A 10: 24,675,092 (GRCm39) H362Y possibly damaging Het
Ess2 A T 16: 17,728,028 (GRCm39) D79E probably damaging Het
Fam83c T A 2: 155,671,299 (GRCm39) Y712F probably damaging Het
Helz C T 11: 107,561,113 (GRCm39) Q1392* probably null Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Iqch T C 9: 63,479,961 (GRCm39) H143R probably benign Het
Itgb5 A G 16: 33,720,881 (GRCm39) D315G probably damaging Het
Kcnmb2 A G 3: 32,236,174 (GRCm39) K141R probably benign Het
Mcm5 T G 8: 75,836,962 (GRCm39) V110G probably damaging Het
Med27 G A 2: 29,361,312 (GRCm39) D163N probably damaging Het
Mms22l C A 4: 24,600,185 (GRCm39) Y1129* probably null Het
Mov10l1 G A 15: 88,931,023 (GRCm39) R1081H probably damaging Het
Mtpap C T 18: 4,380,834 (GRCm39) Q171* probably null Het
Mtpap C G 18: 4,380,833 (GRCm39) N170K probably benign Het
Myo6 T A 9: 80,153,836 (GRCm39) F271I unknown Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nfatc1 C T 18: 80,751,258 (GRCm39) A26T probably benign Het
Or7d11 C A 9: 19,966,543 (GRCm39) C72F probably damaging Het
Piezo2 G C 18: 63,250,815 (GRCm39) T428S probably benign Het
Prkch A G 12: 73,768,616 (GRCm39) E462G probably damaging Het
Rbm20 A G 19: 53,823,131 (GRCm39) Y576C probably damaging Het
Riok3 TTTCATT TTT 18: 12,282,642 (GRCm39) probably null Het
Rpp40 C T 13: 36,080,898 (GRCm39) D302N probably benign Het
Sash1 A G 10: 8,615,969 (GRCm39) V631A probably damaging Het
Sstr2 A G 11: 113,515,203 (GRCm39) T41A probably benign Het
Thsd7b T A 1: 129,843,371 (GRCm39) V861E possibly damaging Het
Tomm70a A G 16: 56,973,070 (GRCm39) K603E possibly damaging Het
Tpd52l2 T A 2: 181,141,683 (GRCm39) M22K possibly damaging Het
Tpst1 T A 5: 130,130,860 (GRCm39) L110Q possibly damaging Het
Tram1l1 A G 3: 124,115,137 (GRCm39) Y99C possibly damaging Het
Ttc39b A G 4: 83,181,977 (GRCm39) F81L possibly damaging Het
Ubr1 A G 2: 120,778,325 (GRCm39) Y238H probably damaging Het
Vmn1r202 G T 13: 22,686,316 (GRCm39) H34N possibly damaging Het
Vmn1r36 G A 6: 66,693,036 (GRCm39) Q280* probably null Het
Xpnpep1 A T 19: 53,000,289 (GRCm39) V187E possibly damaging Het
Zfp592 A G 7: 80,674,349 (GRCm39) I438V probably benign Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103,391,177 (GRCm39) missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103,388,763 (GRCm39) missense unknown
IGL01352:Lrrc37a APN 11 103,390,181 (GRCm39) missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103,389,581 (GRCm39) missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103,394,687 (GRCm39) missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103,395,090 (GRCm39) missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103,389,245 (GRCm39) missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103,347,317 (GRCm39) missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103,395,365 (GRCm39) missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103,388,435 (GRCm39) missense unknown
IGL02218:Lrrc37a APN 11 103,391,207 (GRCm39) missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103,389,003 (GRCm39) missense unknown
IGL02487:Lrrc37a APN 11 103,386,863 (GRCm39) missense unknown
IGL02597:Lrrc37a APN 11 103,395,113 (GRCm39) missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103,389,938 (GRCm39) missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103,392,132 (GRCm39) missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103,382,000 (GRCm39) missense unknown
IGL02987:Lrrc37a APN 11 103,391,239 (GRCm39) missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103,347,421 (GRCm39) missense unknown
IGL03210:Lrrc37a APN 11 103,390,331 (GRCm39) missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103,390,233 (GRCm39) missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03296:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03299:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03370:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03390:Lrrc37a APN 11 103,386,857 (GRCm39) missense unknown
Lark UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
Longspur UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
F5770:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103,393,958 (GRCm39) missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103,395,338 (GRCm39) missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103,391,739 (GRCm39) missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103,390,616 (GRCm39) missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103,355,221 (GRCm39) missense unknown
R0418:Lrrc37a UTSW 11 103,394,264 (GRCm39) missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103,393,851 (GRCm39) missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103,388,457 (GRCm39) missense unknown
R1581:Lrrc37a UTSW 11 103,347,843 (GRCm39) nonsense probably null
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103,347,982 (GRCm39) missense unknown
R1982:Lrrc37a UTSW 11 103,389,792 (GRCm39) missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103,391,951 (GRCm39) missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103,388,648 (GRCm39) missense unknown
R2190:Lrrc37a UTSW 11 103,390,869 (GRCm39) missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R2899:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3439:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3899:Lrrc37a UTSW 11 103,388,372 (GRCm39) missense unknown
R3916:Lrrc37a UTSW 11 103,346,344 (GRCm39) missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103,392,296 (GRCm39) missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103,348,430 (GRCm39) missense unknown
R4043:Lrrc37a UTSW 11 103,389,479 (GRCm39) missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103,388,808 (GRCm39) missense unknown
R4237:Lrrc37a UTSW 11 103,393,115 (GRCm39) missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103,392,624 (GRCm39) missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103,389,795 (GRCm39) missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103,395,363 (GRCm39) missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103,394,930 (GRCm39) missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103,346,306 (GRCm39) missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103,395,135 (GRCm39) missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103,388,438 (GRCm39) missense unknown
R4983:Lrrc37a UTSW 11 103,388,444 (GRCm39) missense unknown
R4989:Lrrc37a UTSW 11 103,347,565 (GRCm39) missense unknown
R5046:Lrrc37a UTSW 11 103,389,066 (GRCm39) missense unknown
R5217:Lrrc37a UTSW 11 103,347,780 (GRCm39) missense unknown
R5300:Lrrc37a UTSW 11 103,347,784 (GRCm39) missense unknown
R5509:Lrrc37a UTSW 11 103,391,361 (GRCm39) missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103,389,003 (GRCm39) missense unknown
R5655:Lrrc37a UTSW 11 103,389,381 (GRCm39) missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103,391,001 (GRCm39) missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103,348,923 (GRCm39) missense unknown
R5815:Lrrc37a UTSW 11 103,394,612 (GRCm39) missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103,389,897 (GRCm39) missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103,391,784 (GRCm39) missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103,393,362 (GRCm39) missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103,347,422 (GRCm39) missense unknown
R6056:Lrrc37a UTSW 11 103,388,484 (GRCm39) missense unknown
R6125:Lrrc37a UTSW 11 103,392,386 (GRCm39) missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103,392,042 (GRCm39) missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103,388,459 (GRCm39) missense unknown
R6320:Lrrc37a UTSW 11 103,394,877 (GRCm39) missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103,355,213 (GRCm39) missense unknown
R6375:Lrrc37a UTSW 11 103,391,915 (GRCm39) missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103,388,361 (GRCm39) missense unknown
R6468:Lrrc37a UTSW 11 103,351,666 (GRCm39) missense unknown
R6490:Lrrc37a UTSW 11 103,347,486 (GRCm39) missense unknown
R6502:Lrrc37a UTSW 11 103,383,005 (GRCm39) missense unknown
R6509:Lrrc37a UTSW 11 103,395,240 (GRCm39) missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103,392,923 (GRCm39) missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103,390,949 (GRCm39) missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103,348,369 (GRCm39) missense unknown
R7081:Lrrc37a UTSW 11 103,348,781 (GRCm39) missense unknown
R7083:Lrrc37a UTSW 11 103,394,166 (GRCm39) missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103,393,682 (GRCm39) missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103,348,601 (GRCm39) missense unknown
R7265:Lrrc37a UTSW 11 103,389,767 (GRCm39) missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103,347,572 (GRCm39) missense unknown
R7362:Lrrc37a UTSW 11 103,348,335 (GRCm39) missense unknown
R7450:Lrrc37a UTSW 11 103,389,152 (GRCm39) missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103,388,258 (GRCm39) missense unknown
R7487:Lrrc37a UTSW 11 103,389,045 (GRCm39) missense unknown
R7535:Lrrc37a UTSW 11 103,392,683 (GRCm39) missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103,391,778 (GRCm39) missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103,390,464 (GRCm39) missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103,389,062 (GRCm39) missense unknown
R7694:Lrrc37a UTSW 11 103,395,204 (GRCm39) missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103,395,126 (GRCm39) missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103,388,285 (GRCm39) missense unknown
R7841:Lrrc37a UTSW 11 103,391,931 (GRCm39) missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103,393,868 (GRCm39) missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103,392,307 (GRCm39) missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103,348,787 (GRCm39) missense unknown
R8051:Lrrc37a UTSW 11 103,393,952 (GRCm39) missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103,348,248 (GRCm39) missense unknown
R8097:Lrrc37a UTSW 11 103,394,925 (GRCm39) missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103,393,883 (GRCm39) missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103,388,724 (GRCm39) missense unknown
R8311:Lrrc37a UTSW 11 103,394,247 (GRCm39) missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103,392,411 (GRCm39) missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103,351,635 (GRCm39) missense unknown
R8529:Lrrc37a UTSW 11 103,348,373 (GRCm39) missense unknown
R8711:Lrrc37a UTSW 11 103,388,350 (GRCm39) nonsense probably null
R8757:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8759:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8769:Lrrc37a UTSW 11 103,389,536 (GRCm39) missense probably benign 0.10
R8785:Lrrc37a UTSW 11 103,347,242 (GRCm39) missense probably damaging 1.00
R8837:Lrrc37a UTSW 11 103,394,795 (GRCm39) missense probably benign 0.43
R8850:Lrrc37a UTSW 11 103,393,481 (GRCm39) missense
R8871:Lrrc37a UTSW 11 103,347,375 (GRCm39) missense unknown
R8894:Lrrc37a UTSW 11 103,347,449 (GRCm39) missense unknown
R8971:Lrrc37a UTSW 11 103,391,490 (GRCm39) missense probably benign 0.19
R8979:Lrrc37a UTSW 11 103,393,833 (GRCm39) missense possibly damaging 0.48
R9012:Lrrc37a UTSW 11 103,389,978 (GRCm39) missense probably benign 0.05
R9047:Lrrc37a UTSW 11 103,391,375 (GRCm39) missense probably damaging 0.97
R9167:Lrrc37a UTSW 11 103,347,658 (GRCm39) missense unknown
R9171:Lrrc37a UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
R9258:Lrrc37a UTSW 11 103,393,022 (GRCm39) missense probably benign 0.20
R9282:Lrrc37a UTSW 11 103,391,633 (GRCm39) missense probably benign 0.03
R9294:Lrrc37a UTSW 11 103,395,359 (GRCm39) missense probably benign 0.10
R9349:Lrrc37a UTSW 11 103,388,454 (GRCm39) missense unknown
R9560:Lrrc37a UTSW 11 103,347,420 (GRCm39) missense unknown
R9595:Lrrc37a UTSW 11 103,392,552 (GRCm39) missense probably benign 0.01
R9628:Lrrc37a UTSW 11 103,394,330 (GRCm39) missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103,390,370 (GRCm39) missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103,391,920 (GRCm39) missense probably benign 0.09
Z1176:Lrrc37a UTSW 11 103,389,860 (GRCm39) missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103,347,312 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc37a UTSW 11 103,391,346 (GRCm39) missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103,390,793 (GRCm39) missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103,393,853 (GRCm39) missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103,391,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGCATAGGTTGAGGAAGTTCC -3'
(R):5'- CCTTTGGATCTGGGACTTACC -3'

Sequencing Primer
(F):5'- AGTTCCTCAGGAGCAGACTGTG -3'
(R):5'- CCTTTGGATCTGGGACTTACCATAAG -3'
Posted On 2022-02-07