Incidental Mutation 'R9195:Tenm4'
ID 697900
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms l7Rn3, Doc4, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 068954-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9195 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 95820453-96560300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96542126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1917 (Y1917N)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: Y1909N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: Y1909N

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: Y1917N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: Y1917N

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107166
AA Change: Y1880N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: Y1880N

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 G C 15: 20,665,517 (GRCm39) T408R probably damaging Het
Ak9 A G 10: 41,283,479 (GRCm39) Y1310C Het
Atp6v1c1 T A 15: 38,674,198 (GRCm39) F64I probably damaging Het
Bahcc1 A G 11: 120,167,337 (GRCm39) E1246G probably benign Het
Brca2 T A 5: 150,463,418 (GRCm39) S1061T possibly damaging Het
Brd10 A G 19: 29,763,703 (GRCm39) I124T Het
Cep83 A G 10: 94,604,801 (GRCm39) R505G possibly damaging Het
Clasp2 A G 9: 113,671,045 (GRCm39) E382G probably benign Het
Cnksr3 A T 10: 7,088,379 (GRCm39) H235Q probably damaging Het
Ctsh A T 9: 89,944,815 (GRCm39) H90L probably benign Het
Cybrd1 G A 2: 70,968,742 (GRCm39) G205D probably damaging Het
Cyfip2 A T 11: 46,161,455 (GRCm39) I345N probably damaging Het
Ech1 T C 7: 28,525,446 (GRCm39) L67P probably damaging Het
Ect2l T C 10: 18,018,836 (GRCm39) N612S probably benign Het
Gm8186 T A 17: 26,318,092 (GRCm39) D35V probably damaging Het
Ighv1-15 T C 12: 114,621,139 (GRCm39) H62R probably benign Het
Kcns1 A T 2: 164,009,778 (GRCm39) L327Q probably damaging Het
Lbr T C 1: 181,663,837 (GRCm39) K61R probably benign Het
Mrpl36 G A 13: 73,479,498 (GRCm39) A3T unknown Het
Nectin3 G A 16: 46,279,259 (GRCm39) R240* probably null Het
Nek10 T C 14: 14,821,139 (GRCm38) L35P probably benign Het
Nr1d1 A G 11: 98,659,883 (GRCm39) V547A possibly damaging Het
Obscn A T 11: 58,942,040 (GRCm39) I4445N probably damaging Het
Or51i2 T C 7: 103,689,345 (GRCm39) I114T probably damaging Het
Pcdhgb1 T G 18: 37,814,157 (GRCm39) V216G probably damaging Het
Pklr T C 3: 89,048,636 (GRCm39) S100P probably damaging Het
R3hdm1 T A 1: 128,089,975 (GRCm39) S70T probably benign Het
Rec114 T G 9: 58,567,534 (GRCm39) T151P probably benign Het
Riok3 TTTCATT TTT 18: 12,282,642 (GRCm39) probably null Het
Slc33a1 A G 3: 63,871,188 (GRCm39) S142P probably damaging Het
Slc4a4 T A 5: 89,281,055 (GRCm39) N407K possibly damaging Het
Slc5a4b A G 10: 75,898,149 (GRCm39) C522R probably damaging Het
Tcim A T 8: 24,928,878 (GRCm39) M12K probably damaging Het
Ttll1 A G 15: 83,373,779 (GRCm39) Y345H probably benign Het
Urb1 A G 16: 90,589,638 (GRCm39) V381A probably benign Het
Wnt16 T C 6: 22,297,932 (GRCm39) M266T probably benign Het
Zfyve26 T C 12: 79,311,168 (GRCm39) I1562V probably benign Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96,517,216 (GRCm39) missense probably benign 0.00
IGL00468:Tenm4 APN 7 96,523,679 (GRCm39) missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96,454,345 (GRCm39) splice site probably benign
IGL00979:Tenm4 APN 7 96,378,598 (GRCm39) missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96,523,474 (GRCm39) missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96,378,592 (GRCm39) missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96,544,384 (GRCm39) missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96,523,510 (GRCm39) missense probably benign 0.00
IGL01579:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01587:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01625:Tenm4 APN 7 96,534,565 (GRCm39) missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96,202,931 (GRCm39) missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96,534,611 (GRCm39) missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96,545,271 (GRCm39) missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96,544,716 (GRCm39) missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96,544,419 (GRCm39) missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96,202,757 (GRCm39) missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96,544,869 (GRCm39) missense probably benign 0.40
IGL02207:Tenm4 APN 7 96,523,323 (GRCm39) missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96,473,029 (GRCm39) missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96,503,941 (GRCm39) missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96,353,344 (GRCm39) missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96,523,281 (GRCm39) missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96,423,383 (GRCm39) unclassified probably benign
IGL02656:Tenm4 APN 7 96,534,640 (GRCm39) missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96,545,426 (GRCm39) missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96,544,205 (GRCm39) nonsense probably null
IGL02863:Tenm4 APN 7 96,522,913 (GRCm39) missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96,492,175 (GRCm39) missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96,522,969 (GRCm39) missense probably damaging 1.00
principium UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
toccata UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
P0026:Tenm4 UTSW 7 96,523,734 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96,545,259 (GRCm39) missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96,378,547 (GRCm39) splice site probably benign
R0277:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96,421,242 (GRCm39) nonsense probably null
R0381:Tenm4 UTSW 7 96,555,088 (GRCm39) missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96,522,973 (GRCm39) missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96,427,058 (GRCm39) missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96,544,830 (GRCm39) missense probably benign 0.35
R0624:Tenm4 UTSW 7 96,423,227 (GRCm39) missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96,545,482 (GRCm39) splice site probably benign
R1037:Tenm4 UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96,497,251 (GRCm39) missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96,199,258 (GRCm39) missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96,492,255 (GRCm39) missense probably benign 0.42
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
R1701:Tenm4 UTSW 7 96,552,096 (GRCm39) missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96,537,892 (GRCm39) missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96,522,987 (GRCm39) missense probably benign 0.17
R1812:Tenm4 UTSW 7 96,545,147 (GRCm39) missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96,544,533 (GRCm39) missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96,555,497 (GRCm39) missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96,552,054 (GRCm39) missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96,555,216 (GRCm39) missense probably benign 0.03
R2329:Tenm4 UTSW 7 96,545,069 (GRCm39) missense probably benign 0.00
R2893:Tenm4 UTSW 7 96,544,197 (GRCm39) missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96,542,332 (GRCm39) splice site probably null
R3409:Tenm4 UTSW 7 96,544,367 (GRCm39) missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3441:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3719:Tenm4 UTSW 7 96,512,770 (GRCm39) missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96,544,979 (GRCm39) missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4441:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4510:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4511:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4543:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4645:Tenm4 UTSW 7 96,544,949 (GRCm39) missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96,544,131 (GRCm39) missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96,446,691 (GRCm39) missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96,555,025 (GRCm39) splice site probably null
R5036:Tenm4 UTSW 7 96,501,768 (GRCm39) missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96,343,997 (GRCm39) missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96,544,995 (GRCm39) missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96,492,164 (GRCm39) missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96,492,356 (GRCm39) missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96,542,293 (GRCm39) missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96,523,410 (GRCm39) missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96,486,538 (GRCm39) missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96,538,034 (GRCm39) missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96,543,887 (GRCm39) missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96,545,416 (GRCm39) nonsense probably null
R5590:Tenm4 UTSW 7 96,446,608 (GRCm39) missense possibly damaging 0.93
R5590:Tenm4 UTSW 7 96,446,607 (GRCm39) missense possibly damaging 0.73
R5597:Tenm4 UTSW 7 96,202,724 (GRCm39) missense probably benign 0.00
R5782:Tenm4 UTSW 7 96,542,246 (GRCm39) missense probably benign 0.00
R5861:Tenm4 UTSW 7 96,492,424 (GRCm39) intron probably benign
R5890:Tenm4 UTSW 7 96,552,067 (GRCm39) missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96,503,926 (GRCm39) missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96,495,102 (GRCm39) missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96,171,640 (GRCm39) intron probably benign
R6060:Tenm4 UTSW 7 96,522,918 (GRCm39) missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96,486,496 (GRCm39) missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96,523,701 (GRCm39) missense probably benign 0.33
R6333:Tenm4 UTSW 7 96,423,331 (GRCm39) missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96,492,251 (GRCm39) missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6746:Tenm4 UTSW 7 96,542,067 (GRCm39) missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96,494,919 (GRCm39) missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96,461,166 (GRCm39) missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96,544,478 (GRCm39) missense probably damaging 1.00
R6807:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6809:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6810:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6811:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6853:Tenm4 UTSW 7 96,486,502 (GRCm39) missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96,446,599 (GRCm39) missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96,544,757 (GRCm39) missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6939:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7011:Tenm4 UTSW 7 96,545,342 (GRCm39) nonsense probably null
R7033:Tenm4 UTSW 7 96,544,430 (GRCm39) nonsense probably null
R7040:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7083:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7239:Tenm4 UTSW 7 96,385,020 (GRCm39) missense possibly damaging 0.47
R7239:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7337:Tenm4 UTSW 7 96,523,333 (GRCm39) missense probably benign 0.44
R7400:Tenm4 UTSW 7 96,344,010 (GRCm39) missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96,423,194 (GRCm39) missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96,523,420 (GRCm39) missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96,423,353 (GRCm39) missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96,495,015 (GRCm39) missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96,486,521 (GRCm39) missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96,497,224 (GRCm39) missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96,538,021 (GRCm39) missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96,495,133 (GRCm39) missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96,545,192 (GRCm39) missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96,542,221 (GRCm39) missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96,512,740 (GRCm39) missense probably benign 0.00
R7692:Tenm4 UTSW 7 96,544,610 (GRCm39) missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96,543,909 (GRCm39) missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96,544,899 (GRCm39) missense probably benign 0.38
R7792:Tenm4 UTSW 7 96,423,221 (GRCm39) missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96,523,081 (GRCm39) missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96,555,587 (GRCm39) missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96,501,564 (GRCm39) missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96,523,512 (GRCm39) missense probably benign 0.44
R8017:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96,378,553 (GRCm39) splice site probably benign
R8061:Tenm4 UTSW 7 96,501,663 (GRCm39) missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96,503,935 (GRCm39) missense probably benign 0.39
R8140:Tenm4 UTSW 7 96,544,383 (GRCm39) missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96,544,614 (GRCm39) missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96,421,313 (GRCm39) critical splice donor site probably null
R8542:Tenm4 UTSW 7 96,461,139 (GRCm39) missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8670:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8683:Tenm4 UTSW 7 96,552,064 (GRCm39) missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8692:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8714:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8716:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8735:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8736:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8737:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,523,047 (GRCm39) missense probably damaging 1.00
R8739:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8776:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96,523,335 (GRCm39) missense probably benign 0.01
R8851:Tenm4 UTSW 7 96,501,710 (GRCm39) missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96,351,952 (GRCm39) splice site probably benign
R8977:Tenm4 UTSW 7 96,461,177 (GRCm39) missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96,495,061 (GRCm39) missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96,473,125 (GRCm39) missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96,473,080 (GRCm39) missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96,421,234 (GRCm39) missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96,534,646 (GRCm39) missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96,545,352 (GRCm39) missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96,545,367 (GRCm39) missense probably benign
R9466:Tenm4 UTSW 7 96,199,252 (GRCm39) missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96,473,056 (GRCm39) missense probably benign
R9626:Tenm4 UTSW 7 96,545,345 (GRCm39) missense probably damaging 1.00
R9673:Tenm4 UTSW 7 96,517,196 (GRCm39) missense probably damaging 1.00
R9676:Tenm4 UTSW 7 96,544,638 (GRCm39) missense probably damaging 1.00
R9678:Tenm4 UTSW 7 96,386,619 (GRCm39) missense possibly damaging 0.94
R9775:Tenm4 UTSW 7 96,555,761 (GRCm39) missense possibly damaging 0.92
R9790:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9791:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9803:Tenm4 UTSW 7 96,202,685 (GRCm39) missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96,523,116 (GRCm39) nonsense probably null
X0026:Tenm4 UTSW 7 96,517,294 (GRCm39) missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96,544,001 (GRCm39) missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96,497,237 (GRCm39) missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96,555,121 (GRCm39) missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96,512,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGAGGTTTGATGCCCACAAC -3'
(R):5'- CACATTTTCCCGTCTGCAAAG -3'

Sequencing Primer
(F):5'- TGATGCCCACAACCTGTGC -3'
(R):5'- TCTGCAAAGATCCGGGATGTG -3'
Posted On 2022-02-07