Incidental Mutation 'R9195:Ak9'
ID 697908
Institutional Source Beutler Lab
Gene Symbol Ak9
Ensembl Gene ENSMUSG00000091415
Gene Name adenylate kinase 9
Synonyms Gm7127, Akd2, Akd1, LOC215946
MMRRC Submission 068954-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9195 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 41179433-41309565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41283479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1310 (Y1310C)
Ref Sequence ENSEMBL: ENSMUSP00000134177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173494]
AlphaFold G3UYQ4
Predicted Effect
SMART Domains Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415
AA Change: Y1310C

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
AAA 391 733 9.11e-1 SMART
Pfam:DUF3508 812 971 1.4e-7 PFAM
AAA 974 1297 1.2e-1 SMART
Blast:AAA 1326 1388 8e-18 BLAST
AAA 1393 1824 1.44e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 G C 15: 20,665,517 (GRCm39) T408R probably damaging Het
Atp6v1c1 T A 15: 38,674,198 (GRCm39) F64I probably damaging Het
Bahcc1 A G 11: 120,167,337 (GRCm39) E1246G probably benign Het
Brca2 T A 5: 150,463,418 (GRCm39) S1061T possibly damaging Het
Brd10 A G 19: 29,763,703 (GRCm39) I124T Het
Cep83 A G 10: 94,604,801 (GRCm39) R505G possibly damaging Het
Clasp2 A G 9: 113,671,045 (GRCm39) E382G probably benign Het
Cnksr3 A T 10: 7,088,379 (GRCm39) H235Q probably damaging Het
Ctsh A T 9: 89,944,815 (GRCm39) H90L probably benign Het
Cybrd1 G A 2: 70,968,742 (GRCm39) G205D probably damaging Het
Cyfip2 A T 11: 46,161,455 (GRCm39) I345N probably damaging Het
Ech1 T C 7: 28,525,446 (GRCm39) L67P probably damaging Het
Ect2l T C 10: 18,018,836 (GRCm39) N612S probably benign Het
Gm8186 T A 17: 26,318,092 (GRCm39) D35V probably damaging Het
Ighv1-15 T C 12: 114,621,139 (GRCm39) H62R probably benign Het
Kcns1 A T 2: 164,009,778 (GRCm39) L327Q probably damaging Het
Lbr T C 1: 181,663,837 (GRCm39) K61R probably benign Het
Mrpl36 G A 13: 73,479,498 (GRCm39) A3T unknown Het
Nectin3 G A 16: 46,279,259 (GRCm39) R240* probably null Het
Nek10 T C 14: 14,821,139 (GRCm38) L35P probably benign Het
Nr1d1 A G 11: 98,659,883 (GRCm39) V547A possibly damaging Het
Obscn A T 11: 58,942,040 (GRCm39) I4445N probably damaging Het
Or51i2 T C 7: 103,689,345 (GRCm39) I114T probably damaging Het
Pcdhgb1 T G 18: 37,814,157 (GRCm39) V216G probably damaging Het
Pklr T C 3: 89,048,636 (GRCm39) S100P probably damaging Het
R3hdm1 T A 1: 128,089,975 (GRCm39) S70T probably benign Het
Rec114 T G 9: 58,567,534 (GRCm39) T151P probably benign Het
Riok3 TTTCATT TTT 18: 12,282,642 (GRCm39) probably null Het
Slc33a1 A G 3: 63,871,188 (GRCm39) S142P probably damaging Het
Slc4a4 T A 5: 89,281,055 (GRCm39) N407K possibly damaging Het
Slc5a4b A G 10: 75,898,149 (GRCm39) C522R probably damaging Het
Tcim A T 8: 24,928,878 (GRCm39) M12K probably damaging Het
Tenm4 T A 7: 96,542,126 (GRCm39) Y1917N probably damaging Het
Ttll1 A G 15: 83,373,779 (GRCm39) Y345H probably benign Het
Urb1 A G 16: 90,589,638 (GRCm39) V381A probably benign Het
Wnt16 T C 6: 22,297,932 (GRCm39) M266T probably benign Het
Zfyve26 T C 12: 79,311,168 (GRCm39) I1562V probably benign Het
Other mutations in Ak9
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mean UTSW 10 41,233,559 (GRCm39) missense possibly damaging 0.59
BB006:Ak9 UTSW 10 41,259,944 (GRCm39) missense
BB016:Ak9 UTSW 10 41,259,944 (GRCm39) missense
R0057:Ak9 UTSW 10 41,268,724 (GRCm39) missense probably benign 0.04
R0605:Ak9 UTSW 10 41,221,135 (GRCm39) missense probably damaging 1.00
R0658:Ak9 UTSW 10 41,223,218 (GRCm39) missense probably damaging 0.98
R1696:Ak9 UTSW 10 41,203,585 (GRCm39) missense possibly damaging 0.73
R1738:Ak9 UTSW 10 41,211,917 (GRCm39) missense possibly damaging 0.86
R1815:Ak9 UTSW 10 41,213,572 (GRCm39) missense probably damaging 1.00
R2900:Ak9 UTSW 10 41,300,751 (GRCm39) missense unknown
R3123:Ak9 UTSW 10 41,234,576 (GRCm39) missense possibly damaging 0.46
R3715:Ak9 UTSW 10 41,233,508 (GRCm39) missense probably damaging 0.96
R4092:Ak9 UTSW 10 41,265,140 (GRCm39) missense probably benign 0.29
R4193:Ak9 UTSW 10 41,211,941 (GRCm39) missense probably benign 0.14
R4598:Ak9 UTSW 10 41,259,907 (GRCm39) missense probably damaging 1.00
R4621:Ak9 UTSW 10 41,282,887 (GRCm39) missense possibly damaging 0.55
R4681:Ak9 UTSW 10 41,303,234 (GRCm39) missense unknown
R4707:Ak9 UTSW 10 41,221,456 (GRCm39) missense probably benign 0.36
R4908:Ak9 UTSW 10 41,296,678 (GRCm39) missense unknown
R4952:Ak9 UTSW 10 41,296,585 (GRCm39) missense probably benign 0.07
R5162:Ak9 UTSW 10 41,233,653 (GRCm39) missense probably damaging 1.00
R5446:Ak9 UTSW 10 41,296,505 (GRCm39) missense possibly damaging 0.70
R5494:Ak9 UTSW 10 41,223,165 (GRCm39) missense probably damaging 1.00
R5517:Ak9 UTSW 10 41,216,887 (GRCm39) missense probably benign 0.23
R5849:Ak9 UTSW 10 41,224,045 (GRCm39) missense probably benign 0.31
R5858:Ak9 UTSW 10 41,299,023 (GRCm39) missense unknown
R5920:Ak9 UTSW 10 41,296,672 (GRCm39) missense probably benign 0.30
R5952:Ak9 UTSW 10 41,233,559 (GRCm39) missense possibly damaging 0.59
R5955:Ak9 UTSW 10 41,234,560 (GRCm39) missense probably damaging 1.00
R6050:Ak9 UTSW 10 41,265,108 (GRCm39) missense possibly damaging 0.74
R6087:Ak9 UTSW 10 41,258,828 (GRCm39) missense probably benign 0.01
R6190:Ak9 UTSW 10 41,298,404 (GRCm39) missense unknown
R6190:Ak9 UTSW 10 41,298,403 (GRCm39) missense unknown
R6197:Ak9 UTSW 10 41,193,826 (GRCm39) missense probably damaging 0.98
R6220:Ak9 UTSW 10 41,246,095 (GRCm39) missense unknown
R6250:Ak9 UTSW 10 41,265,030 (GRCm39) missense possibly damaging 0.54
R6315:Ak9 UTSW 10 41,282,837 (GRCm39) missense possibly damaging 0.55
R6331:Ak9 UTSW 10 41,258,825 (GRCm39) missense probably damaging 0.99
R6812:Ak9 UTSW 10 41,243,163 (GRCm39) missense unknown
R6847:Ak9 UTSW 10 41,233,797 (GRCm39) splice site probably null
R7128:Ak9 UTSW 10 41,300,713 (GRCm39) missense unknown
R7253:Ak9 UTSW 10 41,308,480 (GRCm39) missense unknown
R7286:Ak9 UTSW 10 41,283,367 (GRCm39) missense
R7401:Ak9 UTSW 10 41,299,000 (GRCm39) missense unknown
R7478:Ak9 UTSW 10 41,265,087 (GRCm39) missense
R7698:Ak9 UTSW 10 41,224,072 (GRCm39) missense
R7758:Ak9 UTSW 10 41,223,128 (GRCm39) missense
R7806:Ak9 UTSW 10 41,309,080 (GRCm39) critical splice acceptor site probably null
R7894:Ak9 UTSW 10 41,296,535 (GRCm39) missense unknown
R7929:Ak9 UTSW 10 41,259,944 (GRCm39) missense
R7941:Ak9 UTSW 10 41,285,133 (GRCm39) missense unknown
R8032:Ak9 UTSW 10 41,300,616 (GRCm39) missense unknown
R8143:Ak9 UTSW 10 41,213,588 (GRCm39) nonsense probably null
R8298:Ak9 UTSW 10 41,265,054 (GRCm39) missense
R8301:Ak9 UTSW 10 41,300,712 (GRCm39) missense
R8355:Ak9 UTSW 10 41,275,700 (GRCm39) missense
R8703:Ak9 UTSW 10 41,201,120 (GRCm39) missense
R8728:Ak9 UTSW 10 41,282,959 (GRCm39) missense
R8757:Ak9 UTSW 10 41,299,036 (GRCm39) missense unknown
R8798:Ak9 UTSW 10 41,258,847 (GRCm39) missense
R8868:Ak9 UTSW 10 41,258,869 (GRCm39) nonsense probably null
R8868:Ak9 UTSW 10 41,193,842 (GRCm39) critical splice donor site probably null
R9088:Ak9 UTSW 10 41,282,870 (GRCm39) missense
R9090:Ak9 UTSW 10 41,300,623 (GRCm39) missense unknown
R9165:Ak9 UTSW 10 41,309,235 (GRCm39) missense unknown
R9271:Ak9 UTSW 10 41,300,623 (GRCm39) missense unknown
R9297:Ak9 UTSW 10 41,299,081 (GRCm39) missense unknown
R9302:Ak9 UTSW 10 41,196,486 (GRCm39) missense
R9309:Ak9 UTSW 10 41,192,364 (GRCm39) critical splice donor site probably null
R9318:Ak9 UTSW 10 41,299,081 (GRCm39) missense unknown
R9393:Ak9 UTSW 10 41,285,068 (GRCm39) missense unknown
R9541:Ak9 UTSW 10 41,243,173 (GRCm39) missense
R9579:Ak9 UTSW 10 41,213,576 (GRCm39) missense
R9618:Ak9 UTSW 10 41,203,627 (GRCm39) missense
R9697:Ak9 UTSW 10 41,298,968 (GRCm39) nonsense probably null
R9753:Ak9 UTSW 10 41,259,496 (GRCm39) missense
Z1176:Ak9 UTSW 10 41,299,019 (GRCm39) missense unknown
Z1176:Ak9 UTSW 10 41,224,247 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATCACCAGCTGTGTCTACATAC -3'
(R):5'- TTCCCAGAAGAAGCAATGGTGG -3'

Sequencing Primer
(F):5'- CCAGCTGTGTCTACATACTATAACTG -3'
(R):5'- GCCTCCAAATATTAATGGATAGCAC -3'
Posted On 2022-02-07