Incidental Mutation 'R9195:Acot10'
ID 697919
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Name acyl-CoA thioesterase 10
Synonyms p48, MT-ACT48, Acate3
MMRRC Submission 068954-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9195 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 20665300-20666836 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 20665517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Arginine at position 408 (T408R)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
AlphaFold Q32MW3
Predicted Effect probably damaging
Transcript: ENSMUST00000052910
AA Change: T408R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: T408R

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,283,479 (GRCm39) Y1310C Het
Atp6v1c1 T A 15: 38,674,198 (GRCm39) F64I probably damaging Het
Bahcc1 A G 11: 120,167,337 (GRCm39) E1246G probably benign Het
Brca2 T A 5: 150,463,418 (GRCm39) S1061T possibly damaging Het
Brd10 A G 19: 29,763,703 (GRCm39) I124T Het
Cep83 A G 10: 94,604,801 (GRCm39) R505G possibly damaging Het
Clasp2 A G 9: 113,671,045 (GRCm39) E382G probably benign Het
Cnksr3 A T 10: 7,088,379 (GRCm39) H235Q probably damaging Het
Ctsh A T 9: 89,944,815 (GRCm39) H90L probably benign Het
Cybrd1 G A 2: 70,968,742 (GRCm39) G205D probably damaging Het
Cyfip2 A T 11: 46,161,455 (GRCm39) I345N probably damaging Het
Ech1 T C 7: 28,525,446 (GRCm39) L67P probably damaging Het
Ect2l T C 10: 18,018,836 (GRCm39) N612S probably benign Het
Gm8186 T A 17: 26,318,092 (GRCm39) D35V probably damaging Het
Ighv1-15 T C 12: 114,621,139 (GRCm39) H62R probably benign Het
Kcns1 A T 2: 164,009,778 (GRCm39) L327Q probably damaging Het
Lbr T C 1: 181,663,837 (GRCm39) K61R probably benign Het
Mrpl36 G A 13: 73,479,498 (GRCm39) A3T unknown Het
Nectin3 G A 16: 46,279,259 (GRCm39) R240* probably null Het
Nek10 T C 14: 14,821,139 (GRCm38) L35P probably benign Het
Nr1d1 A G 11: 98,659,883 (GRCm39) V547A possibly damaging Het
Obscn A T 11: 58,942,040 (GRCm39) I4445N probably damaging Het
Or51i2 T C 7: 103,689,345 (GRCm39) I114T probably damaging Het
Pcdhgb1 T G 18: 37,814,157 (GRCm39) V216G probably damaging Het
Pklr T C 3: 89,048,636 (GRCm39) S100P probably damaging Het
R3hdm1 T A 1: 128,089,975 (GRCm39) S70T probably benign Het
Rec114 T G 9: 58,567,534 (GRCm39) T151P probably benign Het
Riok3 TTTCATT TTT 18: 12,282,642 (GRCm39) probably null Het
Slc33a1 A G 3: 63,871,188 (GRCm39) S142P probably damaging Het
Slc4a4 T A 5: 89,281,055 (GRCm39) N407K possibly damaging Het
Slc5a4b A G 10: 75,898,149 (GRCm39) C522R probably damaging Het
Tcim A T 8: 24,928,878 (GRCm39) M12K probably damaging Het
Tenm4 T A 7: 96,542,126 (GRCm39) Y1917N probably damaging Het
Ttll1 A G 15: 83,373,779 (GRCm39) Y345H probably benign Het
Urb1 A G 16: 90,589,638 (GRCm39) V381A probably benign Het
Wnt16 T C 6: 22,297,932 (GRCm39) M266T probably benign Het
Zfyve26 T C 12: 79,311,168 (GRCm39) I1562V probably benign Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20,666,051 (GRCm39) missense probably benign 0.11
IGL01610:Acot10 APN 15 20,665,781 (GRCm39) missense probably damaging 1.00
IGL02457:Acot10 APN 15 20,666,229 (GRCm39) missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20,665,883 (GRCm39) missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20,665,868 (GRCm39) missense probably benign 0.36
ANU23:Acot10 UTSW 15 20,666,051 (GRCm39) missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20,666,684 (GRCm39) missense probably damaging 0.98
R0026:Acot10 UTSW 15 20,666,322 (GRCm39) missense probably benign 0.10
R0026:Acot10 UTSW 15 20,666,322 (GRCm39) missense probably benign 0.10
R0462:Acot10 UTSW 15 20,666,712 (GRCm39) missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20,666,585 (GRCm39) missense probably benign 0.00
R1495:Acot10 UTSW 15 20,665,593 (GRCm39) missense probably damaging 0.99
R2128:Acot10 UTSW 15 20,666,712 (GRCm39) missense probably benign 0.00
R3779:Acot10 UTSW 15 20,665,628 (GRCm39) missense probably damaging 0.98
R4110:Acot10 UTSW 15 20,666,612 (GRCm39) missense probably damaging 1.00
R4111:Acot10 UTSW 15 20,666,612 (GRCm39) missense probably damaging 1.00
R4464:Acot10 UTSW 15 20,665,830 (GRCm39) nonsense probably null
R4668:Acot10 UTSW 15 20,666,028 (GRCm39) missense probably benign
R4933:Acot10 UTSW 15 20,666,416 (GRCm39) missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20,666,018 (GRCm39) missense probably benign 0.01
R5885:Acot10 UTSW 15 20,666,190 (GRCm39) missense probably benign 0.01
R6190:Acot10 UTSW 15 20,665,871 (GRCm39) missense possibly damaging 0.80
R6301:Acot10 UTSW 15 20,666,348 (GRCm39) missense probably benign 0.05
R6805:Acot10 UTSW 15 20,665,452 (GRCm39) missense probably benign 0.42
R7334:Acot10 UTSW 15 20,665,629 (GRCm39) missense possibly damaging 0.86
R7601:Acot10 UTSW 15 20,665,715 (GRCm39) missense probably damaging 1.00
R8400:Acot10 UTSW 15 20,666,258 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGGCAAATTTGTGAACAGGTTC -3'
(R):5'- AGAAGCCTGTTGAAGTTGGTTC -3'

Sequencing Primer
(F):5'- GTGAACAGGTTCTTAAAATTCCATG -3'
(R):5'- AAGCCTGTTGAAGTTGGTTCATTGC -3'
Posted On 2022-02-07