Mutagenetix > Incidental Mutation

Incidental Mutation 'R9196:Abtb2'

697931

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9196 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103683302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 352 (H352L)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076212
AA Change: H352L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: H352L

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

92% (35/38)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,400,646	L176P	probably benign	Het
Adgrf5	T	C	17: 43,445,104	V651A	possibly damaging	Het
Cc2d1b	T	A	4: 108,627,937	L519Q	probably damaging	Het
Ccdc129	A	T	6: 55,975,628	Q852L	probably damaging	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cenpn	G	A	8: 116,931,605	D97N	probably damaging	Het
Cfap54	A	G	10: 93,037,891	C576R	probably benign	Het
Col8a1	A	T	16: 57,627,367	D593E	unknown	Het
Dsel	C	T	1: 111,860,133	E891K	probably benign	Het
Duox1	T	C	2: 122,320,208	Y255H	probably benign	Het
E430018J23Rik	T	C	7: 127,391,589	T409A	probably benign	Het
Fzd6	C	A	15: 39,031,707	L423M	probably damaging	Het
Fzd6	T	G	15: 39,031,708	L423R	probably damaging	Het
Galntl6	G	T	8: 57,962,427	L231I	probably damaging	Het
Grm5	T	C	7: 88,074,310	Y603H	probably damaging	Het
Hepacam	A	T	9: 37,367,756	Q27L	probably benign	Het
Hibadh	C	T	6: 52,548,880	V262I	probably damaging	Het
Hs3st1	T	A	5: 39,614,619	D227V	probably damaging	Het
Inpp1	A	G	1: 52,794,619	L106P	probably damaging	Het
Jmy	T	A	13: 93,464,701	D399V	probably damaging	Het
Krt23	A	T	11: 99,481,029	I332N	probably benign	Het
Lrrc23	T	C	6: 124,778,226	K116R	possibly damaging	Het
Myo10	T	A	15: 25,805,630	I1699N	probably damaging	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Neto1	A	T	18: 86,395,840		probably benign	Het
Nlrp9a	T	A	7: 26,558,733	L592Q	probably damaging	Het
Nol10	A	G	12: 17,405,315	Q439R	probably benign	Het
Pcbp3	A	G	10: 76,785,169	S216P	probably damaging	Het
Pcdhb20	T	A	18: 37,504,971	H183Q	probably benign	Het
Reln	A	C	5: 22,152,473	S198R	probably damaging	Het
Rtn4	T	C	11: 29,708,471	V875A	probably benign	Het
Skiv2l	T	C	17: 34,849,901	S41G	probably benign	Het
Sorbs2	A	G	8: 45,805,827	R1134G	probably benign	Het
Trpc4	A	G	3: 54,222,451	S213G	probably damaging	Het
Unc79	A	G	12: 103,112,354	I1593V	probably benign	Het
Uspl1	T	C	5: 149,214,539	S850P	probably benign	Het
Xrra1	T	C	7: 99,914,492		probably null	Het
Ythdc2	T	A	18: 44,855,397	F717L	probably damaging	Het
Zfp606	T	A	7: 12,494,008	C685*	probably null	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCTGTTAAGGCAAGACTGG -3'
(R):5'- TTTCCTACTTGGTGACCAGGC -3'

Sequencing Primer
(F):5'- CTGTTAAGGCAAGACTGGAAATG -3'
(R):5'- CCTACTTGGTGACCAGGCAAAAATG -3'

Posted On

2022-02-07