Incidental Mutation 'R9196:Abtb2'
ID 697931
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 068955-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9196 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103513647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 352 (H352L)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000076212
AA Change: H352L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: H352L

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,605,644 (GRCm39) L176P probably benign Het
Adgrf5 T C 17: 43,755,995 (GRCm39) V651A possibly damaging Het
Cc2d1b T A 4: 108,485,134 (GRCm39) L519Q probably damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cenpn G A 8: 117,658,344 (GRCm39) D97N probably damaging Het
Cfap54 A G 10: 92,873,753 (GRCm39) C576R probably benign Het
Col8a1 A T 16: 57,447,730 (GRCm39) D593E unknown Het
Dsel C T 1: 111,787,863 (GRCm39) E891K probably benign Het
Duox1 T C 2: 122,150,689 (GRCm39) Y255H probably benign Het
Fzd6 C A 15: 38,895,102 (GRCm39) L423M probably damaging Het
Fzd6 T G 15: 38,895,103 (GRCm39) L423R probably damaging Het
Galntl6 G T 8: 58,415,461 (GRCm39) L231I probably damaging Het
Grm5 T C 7: 87,723,518 (GRCm39) Y603H probably damaging Het
Hepacam A T 9: 37,279,052 (GRCm39) Q27L probably benign Het
Hibadh C T 6: 52,525,865 (GRCm39) V262I probably damaging Het
Hs3st1 T A 5: 39,771,962 (GRCm39) D227V probably damaging Het
Inpp1 A G 1: 52,833,778 (GRCm39) L106P probably damaging Het
Itprid1 A T 6: 55,952,613 (GRCm39) Q852L probably damaging Het
Jmy T A 13: 93,601,209 (GRCm39) D399V probably damaging Het
Krt23 A T 11: 99,371,855 (GRCm39) I332N probably benign Het
Lrrc23 T C 6: 124,755,189 (GRCm39) K116R possibly damaging Het
Myo10 T A 15: 25,805,716 (GRCm39) I1699N probably damaging Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Neto1 A T 18: 86,413,965 (GRCm39) probably benign Het
Nlrp9a T A 7: 26,258,158 (GRCm39) L592Q probably damaging Het
Nol10 A G 12: 17,455,316 (GRCm39) Q439R probably benign Het
Pcbp3 A G 10: 76,621,003 (GRCm39) S216P probably damaging Het
Pcdhb20 T A 18: 37,638,024 (GRCm39) H183Q probably benign Het
Reln A C 5: 22,357,471 (GRCm39) S198R probably damaging Het
Rtn4 T C 11: 29,658,471 (GRCm39) V875A probably benign Het
Skic2 T C 17: 35,068,877 (GRCm39) S41G probably benign Het
Sorbs2 A G 8: 46,258,864 (GRCm39) R1134G probably benign Het
Trpc4 A G 3: 54,129,872 (GRCm39) S213G probably damaging Het
Unc79 A G 12: 103,078,613 (GRCm39) I1593V probably benign Het
Uspl1 T C 5: 149,151,349 (GRCm39) S850P probably benign Het
Xrra1 T C 7: 99,563,699 (GRCm39) probably null Het
Ythdc2 T A 18: 44,988,464 (GRCm39) F717L probably damaging Het
Zfp606 T A 7: 12,227,935 (GRCm39) C685* probably null Het
Zfp764l1 T C 7: 126,990,761 (GRCm39) T409A probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGTTAAGGCAAGACTGG -3'
(R):5'- TTTCCTACTTGGTGACCAGGC -3'

Sequencing Primer
(F):5'- CTGTTAAGGCAAGACTGGAAATG -3'
(R):5'- CCTACTTGGTGACCAGGCAAAAATG -3'
Posted On 2022-02-07