Incidental Mutation 'R9197:Lilra6'
ID 697983
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Name leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Synonyms Pira3, 7M1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9197 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 3908280-3915503 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3912717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 340 (T340A)
Ref Sequence ENSEMBL: ENSMUSP00000042636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
AlphaFold A0A0B4J1F3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038176
AA Change: T340A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: T340A

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090689
AA Change: T302A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: T302A

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,251,052 I2820F unknown Het
4932415D10Rik C A 10: 82,284,567 C4203F possibly damaging Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Brd2 T C 17: 34,114,396 Y427C probably damaging Het
Btbd1 T A 7: 81,793,615 T474S probably damaging Het
Cacna1c T C 6: 118,613,989 T1524A Het
Capn9 T A 8: 124,613,861 V588D probably damaging Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccr3 T C 9: 124,029,695 S356P probably damaging Het
Cyfip1 C T 7: 55,904,474 H754Y probably null Het
Dolk A G 2: 30,284,681 S451P probably damaging Het
Elac2 G A 11: 65,001,856 A829T probably benign Het
Fahd2a T C 2: 127,436,364 I308V possibly damaging Het
Gm7168 T A 17: 13,949,227 N285K probably benign Het
Hgf T A 5: 16,561,061 V65E probably benign Het
Igsf21 A T 4: 140,034,773 L198Q probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ipo4 C T 14: 55,633,383 R264H probably damaging Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Kdm4d T A 9: 14,464,241 Y107F probably damaging Het
Lad1 T A 1: 135,831,892 S509T probably benign Het
Lhx5 C A 5: 120,435,381 P143Q possibly damaging Het
Lrrc4 T C 6: 28,831,319 H99R probably benign Het
Mmp11 T A 10: 75,927,233 D175V probably damaging Het
Msh2 T A 17: 87,719,515 M813K possibly damaging Het
Mvp T C 7: 126,989,787 N603D probably damaging Het
Olfr195 T A 16: 59,149,126 I92N probably damaging Het
Olfr896-ps1 G A 9: 38,292,784 V280M possibly damaging Het
Pcdha2 A C 18: 36,939,826 Y170S probably damaging Het
Pcdhb19 G A 18: 37,498,301 C383Y probably damaging Het
Pcdhga2 A T 18: 37,671,500 D799V probably benign Het
Pias3 A G 3: 96,703,748 Y430C probably benign Het
Pign A G 1: 105,589,093 F575L probably benign Het
Rin3 A T 12: 102,369,047 I406F probably benign Het
Rpgrip1 A T 14: 52,145,400 E674D possibly damaging Het
Snx13 T C 12: 35,105,197 V420A probably benign Het
Spata31d1c A T 13: 65,035,876 M411L probably benign Het
Tmem150a T G 6: 72,356,739 M28R probably benign Het
Trp53 T C 11: 69,589,174 Y233H probably damaging Het
Ufl1 A G 4: 25,250,519 I778T possibly damaging Het
Vmn2r89 T A 14: 51,456,139 H315Q possibly damaging Het
Wapl T A 14: 34,722,287 N565K probably damaging Het
Zfhx2 G A 14: 55,074,722 Q172* probably null Het
Zfp592 T A 7: 81,024,319 S344T possibly damaging Het
Zfp970 T C 2: 177,476,085 I484T probably benign Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3912996 missense probably benign 0.16
R8056:Lilra6 UTSW 7 3912552 missense probably damaging 1.00
R8280:Lilra6 UTSW 7 3913047 missense probably benign 0.01
R9354:Lilra6 UTSW 7 3911629 missense probably damaging 1.00
R9379:Lilra6 UTSW 7 3913167 missense probably damaging 1.00
R9406:Lilra6 UTSW 7 3914854 missense probably benign
R9462:Lilra6 UTSW 7 3911995 missense probably damaging 0.97
Z1176:Lilra6 UTSW 7 3915074 critical splice acceptor site probably null
Z1177:Lilra6 UTSW 7 3912581 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGTTGGAGAGCACTAGGTACTGAC -3'
(R):5'- TCAGATTCTCAACCCCAGGC -3'

Sequencing Primer
(F):5'- ACCACAGTAATGGGGTATTCTTG -3'
(R):5'- GGCTCTGCTCTCAGGAGAACTTC -3'
Posted On 2022-02-07