Incidental Mutation 'R9197:Zfp592'
ID 697985
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 068956-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R9197 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80674067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 344 (S344T)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000107353
AA Change: S344T

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: S344T

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC048679 C T 7: 81,144,966 (GRCm39) V126M probably benign Het
Brd2 T C 17: 34,333,370 (GRCm39) Y427C probably damaging Het
Btbd1 T A 7: 81,443,363 (GRCm39) T474S probably damaging Het
Cacna1c T C 6: 118,590,950 (GRCm39) T1524A Het
Capn9 T A 8: 125,340,600 (GRCm39) V588D probably damaging Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Ccr3 T C 9: 123,829,732 (GRCm39) S356P probably damaging Het
Cplane1 A T 15: 8,280,536 (GRCm39) I2820F unknown Het
Cyfip1 C T 7: 55,554,222 (GRCm39) H754Y probably null Het
Dolk A G 2: 30,174,693 (GRCm39) S451P probably damaging Het
Elac2 G A 11: 64,892,682 (GRCm39) A829T probably benign Het
Fahd2a T C 2: 127,278,284 (GRCm39) I308V possibly damaging Het
Gm7168 T A 17: 14,169,489 (GRCm39) N285K probably benign Het
Hgf T A 5: 16,766,059 (GRCm39) V65E probably benign Het
Igsf21 A T 4: 139,762,084 (GRCm39) L198Q probably benign Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Ipo4 C T 14: 55,870,840 (GRCm39) R264H probably damaging Het
Jak2 C T 19: 29,289,157 (GRCm39) T1103I probably benign Het
Kdm4d T A 9: 14,375,537 (GRCm39) Y107F probably damaging Het
Lad1 T A 1: 135,759,630 (GRCm39) S509T probably benign Het
Lhx5 C A 5: 120,573,446 (GRCm39) P143Q possibly damaging Het
Lilra6 T C 7: 3,915,716 (GRCm39) T340A possibly damaging Het
Lrrc4 T C 6: 28,831,318 (GRCm39) H99R probably benign Het
Mmp11 T A 10: 75,763,067 (GRCm39) D175V probably damaging Het
Msh2 T A 17: 88,026,943 (GRCm39) M813K possibly damaging Het
Mvp T C 7: 126,588,959 (GRCm39) N603D probably damaging Het
Or5k3 T A 16: 58,969,489 (GRCm39) I92N probably damaging Het
Or8c18 G A 9: 38,204,080 (GRCm39) V280M possibly damaging Het
Pcdha2 A C 18: 37,072,879 (GRCm39) Y170S probably damaging Het
Pcdhb19 G A 18: 37,631,354 (GRCm39) C383Y probably damaging Het
Pcdhga2 A T 18: 37,804,553 (GRCm39) D799V probably benign Het
Pias3 A G 3: 96,611,064 (GRCm39) Y430C probably benign Het
Pign A G 1: 105,516,818 (GRCm39) F575L probably benign Het
Rin3 A T 12: 102,335,306 (GRCm39) I406F probably benign Het
Rpgrip1 A T 14: 52,382,857 (GRCm39) E674D possibly damaging Het
Snx13 T C 12: 35,155,196 (GRCm39) V420A probably benign Het
Spata31d1c A T 13: 65,183,690 (GRCm39) M411L probably benign Het
Spata31h1 C A 10: 82,120,401 (GRCm39) C4203F possibly damaging Het
Tmem150a T G 6: 72,333,722 (GRCm39) M28R probably benign Het
Trp53 T C 11: 69,480,000 (GRCm39) Y233H probably damaging Het
Ufl1 A G 4: 25,250,519 (GRCm39) I778T possibly damaging Het
Vmn2r89 T A 14: 51,693,596 (GRCm39) H315Q possibly damaging Het
Wapl T A 14: 34,444,244 (GRCm39) N565K probably damaging Het
Zfhx2 G A 14: 55,312,179 (GRCm39) Q172* probably null Het
Zfp970 T C 2: 177,167,878 (GRCm39) I484T probably benign Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 80,674,227 (GRCm39) missense probably damaging 0.99
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R1918:Zfp592 UTSW 7 80,687,168 (GRCm39) nonsense probably null
R2114:Zfp592 UTSW 7 80,674,544 (GRCm39) missense probably damaging 1.00
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8440:Zfp592 UTSW 7 80,691,271 (GRCm39) missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R8766:Zfp592 UTSW 7 80,674,353 (GRCm39) missense probably benign 0.00
R9083:Zfp592 UTSW 7 80,674,644 (GRCm39) missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTTATCCTCTTGTGTTGCAGC -3'
(R):5'- TGGAGCCTCAGTGATTGTGC -3'

Sequencing Primer
(F):5'- CCTTGGTGGCCTTACAGG -3'
(R):5'- ACTCAGCAGGGGACTTGCTTG -3'
Posted On 2022-02-07