Incidental Mutation 'R9198:Dpyd'
ID 698029
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9198 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 118759654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably null
Transcript: ENSMUST00000039177
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,583 probably null Het
Adamts9 A T 6: 92,860,189 S1164T probably benign Het
Bcat1 A T 6: 145,039,496 I140N probably damaging Het
Bod1l T C 5: 41,799,786 T2832A probably benign Het
Brca2 A T 5: 150,536,512 E417D possibly damaging Het
Ccdc88b T C 19: 6,853,900 D558G possibly damaging Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cenpf G T 1: 189,656,790 T1615K probably damaging Het
Cep250 T C 2: 155,988,434 probably null Het
Clec4d T C 6: 123,274,798 F213S probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Csmd1 G A 8: 15,912,430 R3255W probably damaging Het
Ctsm T C 13: 61,539,798 D82G probably damaging Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Dld A G 12: 31,340,886 V187A probably benign Het
Dmrt2 T A 19: 25,678,113 Y359N probably benign Het
Dnah9 T C 11: 65,955,744 N2914S probably benign Het
Fgl2 A C 5: 21,372,922 Q69P probably damaging Het
Gadd45gip1 A T 8: 84,834,151 I132F probably damaging Het
Gm15446 T C 5: 109,942,877 C332R probably damaging Het
Gm15737 A T 6: 92,879,659 E23V unknown Het
Gm5111 A G 6: 48,590,103 H84R unknown Het
Golga3 G A 5: 110,207,753 S991N probably benign Het
H2-M10.3 A G 17: 36,368,027 Y50H probably damaging Het
Hivep2 C T 10: 14,129,877 H740Y probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ints7 T A 1: 191,619,760 S860R probably benign Het
Lipi T A 16: 75,565,573 T217S possibly damaging Het
Lrrc2 G T 9: 110,962,654 C158F probably benign Het
Lrrc30 T C 17: 67,631,859 D242G probably benign Het
Map1a A T 2: 121,303,373 M1557L probably benign Het
Matn2 A G 15: 34,423,778 E594G probably damaging Het
Mfsd12 T C 10: 81,362,710 L345P probably damaging Het
Mmp24 A G 2: 155,798,121 R124G probably benign Het
Ngef T A 1: 87,479,075 H240L unknown Het
Nmur1 T G 1: 86,387,534 D203A probably benign Het
Nt5c3 T C 6: 56,882,970 Q328R probably benign Het
Ogfr T C 2: 180,591,057 probably null Het
Olfr187 A G 16: 59,035,900 V279A probably benign Het
Olfr655 T A 7: 104,596,428 Y251F probably damaging Het
Olfr728 A T 14: 50,140,533 Y35* probably null Het
Osbpl10 G A 9: 115,232,143 W588* probably null Het
Pask A T 1: 93,337,483 S17T possibly damaging Het
Pfkfb3 C T 2: 11,486,273 R170K probably damaging Het
Plec A G 15: 76,185,737 C960R unknown Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rfx7 T C 9: 72,616,881 L451P probably damaging Het
Rimbp2 T A 5: 128,806,488 E76V probably damaging Het
Rock2 A G 12: 16,965,556 N818S probably benign Het
Ryk A T 9: 102,881,655 I248F possibly damaging Het
Setd2 A G 9: 110,549,100 Q661R possibly damaging Het
Siae T C 9: 37,627,809 V172A probably benign Het
Slc35f4 A G 14: 49,318,920 S9P unknown Het
Smg1 T C 7: 118,195,956 E456G unknown Het
Srgap3 C T 6: 112,766,904 A458T probably damaging Het
Tgfbrap1 T A 1: 43,054,639 R564S probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Usp15 A G 10: 123,168,238 Y204H probably damaging Het
Usp35 A G 7: 97,313,069 Y527H probably damaging Het
Usp8 T A 2: 126,758,604 *1092K probably null Het
Vmn2r73 A T 7: 85,869,779 M545K probably benign Het
Ylpm1 A T 12: 85,033,915 probably null Het
Zscan22 G T 7: 12,907,203 R458L probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTATTCCACATATTGCAAGAGG -3'
(R):5'- AATGCTAATGTCCTGCCCCTAC -3'

Sequencing Primer
(F):5'- CCACATATTGCAAGAGGTATAAAAAC -3'
(R):5'- TGTGGCAACTTGAGATCCAC -3'
Posted On 2022-02-07