Incidental Mutation 'R9198:Siae'
ID 698052
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Name sialic acid acetylesterase
Synonyms LSE, clone 165, Ysg2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R9198 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 37555698-37649655 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37627809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000213126] [ENSMUST00000215474] [ENSMUST00000215829]
AlphaFold P70665
Predicted Effect probably benign
Transcript: ENSMUST00000002007
AA Change: V100A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213126
AA Change: V137A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215474
AA Change: V172A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215829
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,583 probably null Het
Adamts9 A T 6: 92,860,189 S1164T probably benign Het
Bcat1 A T 6: 145,039,496 I140N probably damaging Het
Bod1l T C 5: 41,799,786 T2832A probably benign Het
Brca2 A T 5: 150,536,512 E417D possibly damaging Het
Ccdc88b T C 19: 6,853,900 D558G possibly damaging Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cenpf G T 1: 189,656,790 T1615K probably damaging Het
Cep250 T C 2: 155,988,434 probably null Het
Clec4d T C 6: 123,274,798 F213S probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Csmd1 G A 8: 15,912,430 R3255W probably damaging Het
Ctsm T C 13: 61,539,798 D82G probably damaging Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Dld A G 12: 31,340,886 V187A probably benign Het
Dmrt2 T A 19: 25,678,113 Y359N probably benign Het
Dnah9 T C 11: 65,955,744 N2914S probably benign Het
Dpyd A T 3: 118,759,654 probably null Het
Fgl2 A C 5: 21,372,922 Q69P probably damaging Het
Gadd45gip1 A T 8: 84,834,151 I132F probably damaging Het
Gm15446 T C 5: 109,942,877 C332R probably damaging Het
Gm15737 A T 6: 92,879,659 E23V unknown Het
Gm5111 A G 6: 48,590,103 H84R unknown Het
Golga3 G A 5: 110,207,753 S991N probably benign Het
H2-M10.3 A G 17: 36,368,027 Y50H probably damaging Het
Hivep2 C T 10: 14,129,877 H740Y probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ints7 T A 1: 191,619,760 S860R probably benign Het
Lipi T A 16: 75,565,573 T217S possibly damaging Het
Lrrc2 G T 9: 110,962,654 C158F probably benign Het
Lrrc30 T C 17: 67,631,859 D242G probably benign Het
Map1a A T 2: 121,303,373 M1557L probably benign Het
Matn2 A G 15: 34,423,778 E594G probably damaging Het
Mfsd12 T C 10: 81,362,710 L345P probably damaging Het
Mmp24 A G 2: 155,798,121 R124G probably benign Het
Ngef T A 1: 87,479,075 H240L unknown Het
Nmur1 T G 1: 86,387,534 D203A probably benign Het
Nt5c3 T C 6: 56,882,970 Q328R probably benign Het
Ogfr T C 2: 180,591,057 probably null Het
Olfr187 A G 16: 59,035,900 V279A probably benign Het
Olfr655 T A 7: 104,596,428 Y251F probably damaging Het
Olfr728 A T 14: 50,140,533 Y35* probably null Het
Osbpl10 G A 9: 115,232,143 W588* probably null Het
Pask A T 1: 93,337,483 S17T possibly damaging Het
Pfkfb3 C T 2: 11,486,273 R170K probably damaging Het
Plec A G 15: 76,185,737 C960R unknown Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rfx7 T C 9: 72,616,881 L451P probably damaging Het
Rimbp2 T A 5: 128,806,488 E76V probably damaging Het
Rock2 A G 12: 16,965,556 N818S probably benign Het
Ryk A T 9: 102,881,655 I248F possibly damaging Het
Setd2 A G 9: 110,549,100 Q661R possibly damaging Het
Slc35f4 A G 14: 49,318,920 S9P unknown Het
Smg1 T C 7: 118,195,956 E456G unknown Het
Srgap3 C T 6: 112,766,904 A458T probably damaging Het
Tgfbrap1 T A 1: 43,054,639 R564S probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Usp15 A G 10: 123,168,238 Y204H probably damaging Het
Usp35 A G 7: 97,313,069 Y527H probably damaging Het
Usp8 T A 2: 126,758,604 *1092K probably null Het
Vmn2r73 A T 7: 85,869,779 M545K probably benign Het
Ylpm1 A T 12: 85,033,915 probably null Het
Zscan22 G T 7: 12,907,203 R458L probably damaging Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7697:Siae UTSW 9 37633654 missense probably damaging 1.00
R7821:Siae UTSW 9 37644900 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8312:Siae UTSW 9 37646297 missense
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
R8868:Siae UTSW 9 37616836 missense probably damaging 1.00
R9014:Siae UTSW 9 37646343 missense possibly damaging 0.74
R9447:Siae UTSW 9 37646447 missense probably benign 0.08
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTACTGAGAAGCTGCAAGGC -3'
(R):5'- CTGAACTCAGTGGAGAAGATTCAG -3'

Sequencing Primer
(F):5'- GCAAGGCAGTTTAACCTCTTTCAG -3'
(R):5'- AGAAGATTCAGGCTGGGTTC -3'
Posted On 2022-02-07