Incidental Mutation 'R9198:Lipi'
ID 698073
Institutional Source Beutler Lab
Gene Symbol Lipi
Ensembl Gene ENSMUSG00000032948
Gene Name lipase, member I
Synonyms lpd1, D930038D03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R9198 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 75540514-75586061 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75565573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 217 (T217S)
Ref Sequence ENSEMBL: ENSMUSP00000053447 (fasta)
AlphaFold F6YQT7
Predicted Effect possibly damaging
Transcript: ENSMUST00000062721
AA Change: T217S

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phospholipase that hydrolyzes phosphatidic acid to produce lysophosphatidic acid. Defects in this gene are a cause of susceptibility to familial hypertrigliceridemia. This gene is also expressed at high levels in Ewing family tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit postnatal lethality, tremors, abnormal gait, decreased body weight, retarded hair growth, and a defect in triglyceride metabolism resulting in hypertriglyceridemia and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,583 probably null Het
Adamts9 A T 6: 92,860,189 S1164T probably benign Het
Bcat1 A T 6: 145,039,496 I140N probably damaging Het
Bod1l T C 5: 41,799,786 T2832A probably benign Het
Brca2 A T 5: 150,536,512 E417D possibly damaging Het
Ccdc88b T C 19: 6,853,900 D558G possibly damaging Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cenpf G T 1: 189,656,790 T1615K probably damaging Het
Cep250 T C 2: 155,988,434 probably null Het
Clec4d T C 6: 123,274,798 F213S probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Csmd1 G A 8: 15,912,430 R3255W probably damaging Het
Ctsm T C 13: 61,539,798 D82G probably damaging Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Dld A G 12: 31,340,886 V187A probably benign Het
Dmrt2 T A 19: 25,678,113 Y359N probably benign Het
Dnah9 T C 11: 65,955,744 N2914S probably benign Het
Dpyd A T 3: 118,759,654 probably null Het
Fgl2 A C 5: 21,372,922 Q69P probably damaging Het
Gadd45gip1 A T 8: 84,834,151 I132F probably damaging Het
Gm15446 T C 5: 109,942,877 C332R probably damaging Het
Gm15737 A T 6: 92,879,659 E23V unknown Het
Gm5111 A G 6: 48,590,103 H84R unknown Het
Golga3 G A 5: 110,207,753 S991N probably benign Het
H2-M10.3 A G 17: 36,368,027 Y50H probably damaging Het
Hivep2 C T 10: 14,129,877 H740Y probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ints7 T A 1: 191,619,760 S860R probably benign Het
Lrrc2 G T 9: 110,962,654 C158F probably benign Het
Lrrc30 T C 17: 67,631,859 D242G probably benign Het
Map1a A T 2: 121,303,373 M1557L probably benign Het
Matn2 A G 15: 34,423,778 E594G probably damaging Het
Mfsd12 T C 10: 81,362,710 L345P probably damaging Het
Mmp24 A G 2: 155,798,121 R124G probably benign Het
Ngef T A 1: 87,479,075 H240L unknown Het
Nmur1 T G 1: 86,387,534 D203A probably benign Het
Nt5c3 T C 6: 56,882,970 Q328R probably benign Het
Ogfr T C 2: 180,591,057 probably null Het
Olfr187 A G 16: 59,035,900 V279A probably benign Het
Olfr655 T A 7: 104,596,428 Y251F probably damaging Het
Olfr728 A T 14: 50,140,533 Y35* probably null Het
Osbpl10 G A 9: 115,232,143 W588* probably null Het
Pask A T 1: 93,337,483 S17T possibly damaging Het
Pfkfb3 C T 2: 11,486,273 R170K probably damaging Het
Plec A G 15: 76,185,737 C960R unknown Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rfx7 T C 9: 72,616,881 L451P probably damaging Het
Rimbp2 T A 5: 128,806,488 E76V probably damaging Het
Rock2 A G 12: 16,965,556 N818S probably benign Het
Ryk A T 9: 102,881,655 I248F possibly damaging Het
Setd2 A G 9: 110,549,100 Q661R possibly damaging Het
Siae T C 9: 37,627,809 V172A probably benign Het
Slc35f4 A G 14: 49,318,920 S9P unknown Het
Smg1 T C 7: 118,195,956 E456G unknown Het
Srgap3 C T 6: 112,766,904 A458T probably damaging Het
Tgfbrap1 T A 1: 43,054,639 R564S probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Usp15 A G 10: 123,168,238 Y204H probably damaging Het
Usp35 A G 7: 97,313,069 Y527H probably damaging Het
Usp8 T A 2: 126,758,604 *1092K probably null Het
Vmn2r73 A T 7: 85,869,779 M545K probably benign Het
Ylpm1 A T 12: 85,033,915 probably null Het
Zscan22 G T 7: 12,907,203 R458L probably damaging Het
Other mutations in Lipi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Lipi APN 16 75550366 splice site probably benign
IGL01863:Lipi APN 16 75550226 missense probably damaging 1.00
R1690:Lipi UTSW 16 75541125 missense probably damaging 1.00
R2045:Lipi UTSW 16 75550199 missense probably damaging 0.98
R4001:Lipi UTSW 16 75573871 nonsense probably null
R4387:Lipi UTSW 16 75573955 missense probably damaging 1.00
R4613:Lipi UTSW 16 75560801 missense probably benign 0.01
R4680:Lipi UTSW 16 75565529 critical splice donor site probably null
R5420:Lipi UTSW 16 75555869 missense possibly damaging 0.82
R5503:Lipi UTSW 16 75573976 missense probably benign 0.11
R5773:Lipi UTSW 16 75573925 missense probably damaging 1.00
R5813:Lipi UTSW 16 75573910 missense possibly damaging 0.91
R6312:Lipi UTSW 16 75573915 missense probably damaging 1.00
R6559:Lipi UTSW 16 75541094 missense probably benign 0.31
R7587:Lipi UTSW 16 75550215 missense probably benign 0.00
R7639:Lipi UTSW 16 75560855 missense probably benign 0.03
R8079:Lipi UTSW 16 75565530 critical splice donor site probably null
R8256:Lipi UTSW 16 75574062 missense probably benign 0.00
R8475:Lipi UTSW 16 75573974 missense probably benign 0.00
R8855:Lipi UTSW 16 75558593 missense probably damaging 1.00
R8888:Lipi UTSW 16 75555822 missense probably benign 0.05
R8895:Lipi UTSW 16 75555822 missense probably benign 0.05
R9112:Lipi UTSW 16 75562271 missense probably damaging 1.00
R9182:Lipi UTSW 16 75560785 nonsense probably null
X0017:Lipi UTSW 16 75550355 missense probably benign 0.00
X0019:Lipi UTSW 16 75555815 missense probably benign
Z1177:Lipi UTSW 16 75550287 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTAAAGTCAGTGACTGCCCAC -3'
(R):5'- AATGCCTTTGAAGGGTGCTG -3'

Sequencing Primer
(F):5'- ACAGAATGGAGAATTAAATCCCAAAC -3'
(R):5'- CCTTTGAAGGGTGCTGATAAATATTC -3'
Posted On 2022-02-07