Incidental Mutation 'R9200:Smyd3'
ID 698139
Institutional Source Beutler Lab
Gene Symbol Smyd3
Ensembl Gene ENSMUSG00000055067
Gene Name SET and MYND domain containing 3
Synonyms 2410008A19Rik, Zmynd1
MMRRC Submission
Accession Numbers

Genbank: NM_027188; MGI: 1916976; Ensembl: ENSMUST00000128302, ENSMUST00000111134, ENSMUST00000111133

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9200 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 178951960-179518041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 179405398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000117410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111134] [ENSMUST00000128302]
AlphaFold Q9CWR2
Predicted Effect probably benign
Transcript: ENSMUST00000111134
AA Change: D139G

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106764
Gene: ENSMUSG00000055067
AA Change: D139G

DomainStartEndE-ValueType
Pfam:zf-MYND 40 87 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128302
AA Change: D139G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117410
Gene: ENSMUSG00000055067
AA Change: D139G

DomainStartEndE-ValueType
SET 4 246 1.04e-11 SMART
low complexity region 410 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which functions in RNA polymerase II complexes by an interaction with a specific RNA helicase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted, other(5) Gene trapped(29)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,856,034 L275P possibly damaging Het
Acsm2 C A 7: 119,580,616 Y352* probably null Het
Adh7 C T 3: 138,221,806 R38C probably benign Het
Ankrd2 A T 19: 42,040,432 T145S Het
Anpep T C 7: 79,841,122 N241D probably benign Het
Apaf1 G A 10: 91,009,240 L990F probably benign Het
Arsi A G 18: 60,916,764 T240A possibly damaging Het
Ascc3 A G 10: 50,645,691 E434G possibly damaging Het
Atp2c2 A T 8: 119,748,260 K535* probably null Het
B3galt4 A G 17: 33,951,410 probably benign Het
Brwd1 C G 16: 96,037,954 C839S probably benign Het
Cars C T 7: 143,575,917 probably null Het
Catsperd T A 17: 56,628,229 V14D unknown Het
Ccdc150 A C 1: 54,260,038 T58P probably damaging Het
Cdon A G 9: 35,503,321 D1164G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cic A C 7: 25,272,515 D557A probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Dach1 G T 14: 97,828,307 R695S probably damaging Het
Ddc T C 11: 11,815,388 N428S possibly damaging Het
Dnah6 G A 6: 73,027,514 T3822I probably benign Het
Dnmt1 T A 9: 20,908,600 M1535L probably benign Het
Edc4 T C 8: 105,890,419 probably null Het
Emilin2 A G 17: 71,274,234 I499T possibly damaging Het
Etl4 A G 2: 20,781,891 D766G probably damaging Het
Fes T C 7: 80,382,392 Q414R probably benign Het
Fhod1 A G 8: 105,331,440 V844A probably benign Het
Fshr A T 17: 89,046,675 V85E probably benign Het
Gc T C 5: 89,445,377 N61S probably benign Het
Gm13089 G A 4: 143,697,286 P311L possibly damaging Het
Gm28710 T C 5: 16,801,661 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itga1 A T 13: 114,968,461 I1059N possibly damaging Het
Itpr3 T A 17: 27,107,662 V1426E probably damaging Het
Jag1 T A 2: 137,087,124 Y804F probably benign Het
Lama3 A G 18: 12,472,240 T1084A probably benign Het
Mdn1 A G 4: 32,760,791 D4952G probably benign Het
Mmrn1 A G 6: 60,976,876 T714A probably damaging Het
Nab1 T A 1: 52,490,366 H124L possibly damaging Het
Nacc2 A G 2: 26,090,106 F106S probably damaging Het
Nbeal1 T C 1: 60,281,266 I2006T probably damaging Het
Nkpd1 C A 7: 19,523,758 H487Q probably benign Het
Nop2 G A 6: 125,140,880 probably null Het
Olfr1116 T A 2: 87,269,711 M310K probably benign Het
Olfr1489 A G 19: 13,633,231 N40S probably damaging Het
Otud6b A T 4: 14,811,712 Y310* probably null Het
Phyh A T 2: 4,927,436 Y111F probably benign Het
Pon3 A G 6: 5,240,863 L106P probably benign Het
Ppp6r3 T C 19: 3,469,748 D615G probably damaging Het
Prdm10 G A 9: 31,357,142 V796I probably damaging Het
Prkdc G T 16: 15,705,289 V1192F probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rab39 T C 9: 53,686,365 N200S probably benign Het
Rcc2 A G 4: 140,718,353 I441V probably benign Het
Rxra G A 2: 27,737,484 V72I possibly damaging Het
Ryr1 T G 7: 29,095,099 Q1252P probably benign Het
Sectm1a T C 11: 121,069,647 Y114C probably damaging Het
Smim1 T C 4: 154,023,819 probably null Het
Smpd2 C T 10: 41,487,565 D301N probably benign Het
Sox13 C T 1: 133,386,005 C399Y probably damaging Het
Tarsl2 A G 7: 65,652,265 E179G probably benign Het
Tas2r138 A G 6: 40,612,560 F251L probably damaging Het
Tesk1 A G 4: 43,447,307 E565G probably damaging Het
Tm2d1 A T 4: 98,357,963 F201I possibly damaging Het
Tom1l2 C A 11: 60,230,116 D501Y probably benign Het
Trim39 G T 17: 36,268,775 T96K probably benign Het
Ubash3a A G 17: 31,217,997 H196R probably damaging Het
Unc13b A G 4: 43,257,352 E1206G possibly damaging Het
Usp17lc A T 7: 103,418,898 T467S probably benign Het
Vmn1r128 T C 7: 21,349,391 S7P possibly damaging Het
Vmn1r185 T A 7: 26,611,648 H144L possibly damaging Het
Wfdc6b A T 2: 164,613,788 R12S possibly damaging Het
Zmynd8 A T 2: 165,840,085 D175E probably benign Het
Other mutations in Smyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Smyd3 APN 1 178972279 missense probably benign
IGL03088:Smyd3 APN 1 179094333 critical splice donor site probably null
D3080:Smyd3 UTSW 1 179086422 missense probably damaging 1.00
R0165:Smyd3 UTSW 1 179043872 missense probably benign
R0230:Smyd3 UTSW 1 179423428 splice site probably benign
R0390:Smyd3 UTSW 1 178957573 splice site probably benign
R1651:Smyd3 UTSW 1 179043876 missense probably benign
R4651:Smyd3 UTSW 1 179043741 missense probably benign 0.08
R4771:Smyd3 UTSW 1 179094396 missense probably damaging 0.99
R5326:Smyd3 UTSW 1 179410459 missense probably benign
R5542:Smyd3 UTSW 1 179410459 missense probably benign
R5697:Smyd3 UTSW 1 179411682 missense probably damaging 1.00
R5850:Smyd3 UTSW 1 179043855 missense probably damaging 1.00
R6732:Smyd3 UTSW 1 179395830 missense probably benign 0.01
R7782:Smyd3 UTSW 1 178972294 missense possibly damaging 0.94
R8065:Smyd3 UTSW 1 179410463 missense possibly damaging 0.60
R8067:Smyd3 UTSW 1 179410463 missense possibly damaging 0.60
R8236:Smyd3 UTSW 1 179405640 splice site probably null
R8735:Smyd3 UTSW 1 179092917 missense probably benign 0.12
R9146:Smyd3 UTSW 1 179092964 missense probably damaging 1.00
R9185:Smyd3 UTSW 1 179050289 critical splice donor site probably null
R9372:Smyd3 UTSW 1 179043905 missense possibly damaging 0.92
X0024:Smyd3 UTSW 1 179050289 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATCAAGGCTTAGGCATGTTTG -3'
(R):5'- GGTAAAAGATCTGGCAGTGTGC -3'

Sequencing Primer
(F):5'- CATGTTTGCAAATGACAAGAAAACAG -3'
(R):5'- AAAACCCGTATGCATCTGTTTAG -3'
Posted On 2022-02-07