Incidental Mutation 'R9200:Unc13b'
ID 698151
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Name unc-13 homolog B (C. elegans)
Synonyms Unc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R9200 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43058953-43264871 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43257352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1206 (E1206G)
Ref Sequence ENSEMBL: ENSMUSP00000103586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000145899] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
AlphaFold Q9Z1N9
Predicted Effect possibly damaging
Transcript: ENSMUST00000079978
AA Change: E1194G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: E1194G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107952
AA Change: E1206G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: E1206G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107953
AA Change: E1194G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: E1194G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145899
AA Change: E106G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128638
Gene: ENSMUSG00000028456
AA Change: E106G

DomainStartEndE-ValueType
PDB:3SWH|B 16 190 1e-84 PDB
Blast:DUF1041 55 129 2e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000163653
AA Change: E1205G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: E1205G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207569
AA Change: E3994G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207708
AA Change: E1567G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2236 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,856,034 L275P possibly damaging Het
Acsm2 C A 7: 119,580,616 Y352* probably null Het
Adh7 C T 3: 138,221,806 R38C probably benign Het
Ankrd2 A T 19: 42,040,432 T145S Het
Anpep T C 7: 79,841,122 N241D probably benign Het
Apaf1 G A 10: 91,009,240 L990F probably benign Het
Arsi A G 18: 60,916,764 T240A possibly damaging Het
Ascc3 A G 10: 50,645,691 E434G possibly damaging Het
Atp2c2 A T 8: 119,748,260 K535* probably null Het
B3galt4 A G 17: 33,951,410 probably benign Het
Brwd1 C G 16: 96,037,954 C839S probably benign Het
Cars C T 7: 143,575,917 probably null Het
Catsperd T A 17: 56,628,229 V14D unknown Het
Ccdc150 A C 1: 54,260,038 T58P probably damaging Het
Cdon A G 9: 35,503,321 D1164G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cic A C 7: 25,272,515 D557A probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Dach1 G T 14: 97,828,307 R695S probably damaging Het
Ddc T C 11: 11,815,388 N428S possibly damaging Het
Dnah6 G A 6: 73,027,514 T3822I probably benign Het
Dnmt1 T A 9: 20,908,600 M1535L probably benign Het
Edc4 T C 8: 105,890,419 probably null Het
Emilin2 A G 17: 71,274,234 I499T possibly damaging Het
Etl4 A G 2: 20,781,891 D766G probably damaging Het
Fes T C 7: 80,382,392 Q414R probably benign Het
Fhod1 A G 8: 105,331,440 V844A probably benign Het
Fshr A T 17: 89,046,675 V85E probably benign Het
Gc T C 5: 89,445,377 N61S probably benign Het
Gm13089 G A 4: 143,697,286 P311L possibly damaging Het
Gm28710 T C 5: 16,801,661 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itga1 A T 13: 114,968,461 I1059N possibly damaging Het
Itpr3 T A 17: 27,107,662 V1426E probably damaging Het
Jag1 T A 2: 137,087,124 Y804F probably benign Het
Lama3 A G 18: 12,472,240 T1084A probably benign Het
Mdn1 A G 4: 32,760,791 D4952G probably benign Het
Mmrn1 A G 6: 60,976,876 T714A probably damaging Het
Nab1 T A 1: 52,490,366 H124L possibly damaging Het
Nacc2 A G 2: 26,090,106 F106S probably damaging Het
Nbeal1 T C 1: 60,281,266 I2006T probably damaging Het
Nkpd1 C A 7: 19,523,758 H487Q probably benign Het
Nop2 G A 6: 125,140,880 probably null Het
Olfr1116 T A 2: 87,269,711 M310K probably benign Het
Olfr1489 A G 19: 13,633,231 N40S probably damaging Het
Otud6b A T 4: 14,811,712 Y310* probably null Het
Phyh A T 2: 4,927,436 Y111F probably benign Het
Pon3 A G 6: 5,240,863 L106P probably benign Het
Ppp6r3 T C 19: 3,469,748 D615G probably damaging Het
Prdm10 G A 9: 31,357,142 V796I probably damaging Het
Prkdc G T 16: 15,705,289 V1192F probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rab39 T C 9: 53,686,365 N200S probably benign Het
Rcc2 A G 4: 140,718,353 I441V probably benign Het
Rxra G A 2: 27,737,484 V72I possibly damaging Het
Ryr1 T G 7: 29,095,099 Q1252P probably benign Het
Sectm1a T C 11: 121,069,647 Y114C probably damaging Het
Smim1 T C 4: 154,023,819 probably null Het
Smpd2 C T 10: 41,487,565 D301N probably benign Het
Smyd3 T C 1: 179,405,398 D139G probably benign Het
Sox13 C T 1: 133,386,005 C399Y probably damaging Het
Tarsl2 A G 7: 65,652,265 E179G probably benign Het
Tas2r138 A G 6: 40,612,560 F251L probably damaging Het
Tesk1 A G 4: 43,447,307 E565G probably damaging Het
Tm2d1 A T 4: 98,357,963 F201I possibly damaging Het
Tom1l2 C A 11: 60,230,116 D501Y probably benign Het
Trim39 G T 17: 36,268,775 T96K probably benign Het
Ubash3a A G 17: 31,217,997 H196R probably damaging Het
Usp17lc A T 7: 103,418,898 T467S probably benign Het
Vmn1r128 T C 7: 21,349,391 S7P possibly damaging Het
Vmn1r185 T A 7: 26,611,648 H144L possibly damaging Het
Wfdc6b A T 2: 164,613,788 R12S possibly damaging Het
Zmynd8 A T 2: 165,840,085 D175E probably benign Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43174399 missense unknown
BB016:Unc13b UTSW 4 43174399 missense unknown
G1Funyon:Unc13b UTSW 4 43263568 missense probably benign
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7929:Unc13b UTSW 4 43174399 missense unknown
R7984:Unc13b UTSW 4 43173973 missense unknown
R8069:Unc13b UTSW 4 43177597 missense unknown
R8101:Unc13b UTSW 4 43239918 missense probably benign 0.08
R8246:Unc13b UTSW 4 43175954 missense unknown
R8289:Unc13b UTSW 4 43172524 nonsense probably null
R8301:Unc13b UTSW 4 43263568 missense probably benign
R8397:Unc13b UTSW 4 43217290 missense probably benign 0.12
R8421:Unc13b UTSW 4 43178304 missense unknown
R8738:Unc13b UTSW 4 43177564 missense unknown
R8746:Unc13b UTSW 4 43176120 missense unknown
R8766:Unc13b UTSW 4 43174722 missense unknown
R8825:Unc13b UTSW 4 43237683 splice site probably benign
R8834:Unc13b UTSW 4 43175954 missense unknown
R8862:Unc13b UTSW 4 43235207 missense probably damaging 1.00
R8864:Unc13b UTSW 4 43174724 missense unknown
R8889:Unc13b UTSW 4 43176484 missense unknown
R8892:Unc13b UTSW 4 43176484 missense unknown
R8904:Unc13b UTSW 4 43178531 intron probably benign
R9089:Unc13b UTSW 4 43095847 missense probably damaging 1.00
R9144:Unc13b UTSW 4 43173649 missense unknown
R9149:Unc13b UTSW 4 43176186 missense unknown
R9173:Unc13b UTSW 4 43177421 missense unknown
R9232:Unc13b UTSW 4 43240321 missense probably benign 0.03
R9269:Unc13b UTSW 4 43171955 missense unknown
R9320:Unc13b UTSW 4 43171044 missense unknown
R9335:Unc13b UTSW 4 43216123 missense possibly damaging 0.86
R9335:Unc13b UTSW 4 43255551 missense probably damaging 0.99
R9352:Unc13b UTSW 4 43177312 small insertion probably benign
R9352:Unc13b UTSW 4 43177313 nonsense probably null
R9378:Unc13b UTSW 4 43173282 missense unknown
R9382:Unc13b UTSW 4 43172512 missense unknown
R9569:Unc13b UTSW 4 43177312 small deletion probably benign
R9622:Unc13b UTSW 4 43172513 missense
R9687:Unc13b UTSW 4 43174920 missense unknown
R9704:Unc13b UTSW 4 43237102 missense probably benign 0.31
R9721:Unc13b UTSW 4 43101869 missense probably benign
R9753:Unc13b UTSW 4 43182842 nonsense probably null
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGACTTCTCTGAATTGGCTTTAG -3'
(R):5'- AACCCAGTGGCTACTTTTCC -3'

Sequencing Primer
(F):5'- AATGTGAAGTGCCTGTAGCC -3'
(R):5'- CTTTCCAGGATTTTACCACAGTG -3'
Posted On 2022-02-07