Mutagenetix > Incidental Mutation

Incidental Mutation 'R9200:Unc13b'

698151

Institutional Source

Beutler Lab

Gene Symbol

Unc13b

Ensembl Gene

ENSMUSG00000028456

Gene Name

unc-13 homolog B (C. elegans)

Synonyms

Unc13h2, Munc13-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R9200 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43058953-43264871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43257352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1206 (E1206G)

Ref Sequence

ENSEMBL: ENSMUSP00000103586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000145899] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]

AlphaFold

Q9Z1N9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079978
AA Change: E1194G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: E1194G

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1262	1404	4.8e-60	PFAM
C2	1438	1544	7.56e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107952
AA Change: E1206G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: E1206G

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1033	2.02e-53	SMART
Pfam:Membr_traf_MHD	1274	1416	4.8e-60	PFAM
C2	1450	1556	7.56e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107953
AA Change: E1194G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: E1194G

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1263	1403	2.3e-56	PFAM
C2	1457	1563	7.56e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145899
AA Change: E106G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128638
Gene: ENSMUSG00000028456
AA Change: E106G

Domain	Start	End	E-Value	Type
PDB:3SWH\|B	16	190	1e-84	PDB
Blast:DUF1041	55	129	2e-6	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163653
AA Change: E1205G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: E1205G

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1032	4.64e-53	SMART
Pfam:Membr_traf_MHD	1273	1415	4.8e-60	PFAM
C2	1449	1555	7.56e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207569
AA Change: E3994G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207708
AA Change: E1567G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.2236

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	C	16: 8,856,034	L275P	possibly damaging	Het
Acsm2	C	A	7: 119,580,616	Y352*	probably null	Het
Adh7	C	T	3: 138,221,806	R38C	probably benign	Het
Ankrd2	A	T	19: 42,040,432	T145S		Het
Anpep	T	C	7: 79,841,122	N241D	probably benign	Het
Apaf1	G	A	10: 91,009,240	L990F	probably benign	Het
Arsi	A	G	18: 60,916,764	T240A	possibly damaging	Het
Ascc3	A	G	10: 50,645,691	E434G	possibly damaging	Het
Atp2c2	A	T	8: 119,748,260	K535*	probably null	Het
B3galt4	A	G	17: 33,951,410		probably benign	Het
Brwd1	C	G	16: 96,037,954	C839S	probably benign	Het
Cars	C	T	7: 143,575,917		probably null	Het
Catsperd	T	A	17: 56,628,229	V14D	unknown	Het
Ccdc150	A	C	1: 54,260,038	T58P	probably damaging	Het
Cdon	A	G	9: 35,503,321	D1164G	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cic	A	C	7: 25,272,515	D557A	probably damaging	Het
Clip4	G	A	17: 71,810,889	G310R	probably damaging	Het
Dach1	G	T	14: 97,828,307	R695S	probably damaging	Het
Ddc	T	C	11: 11,815,388	N428S	possibly damaging	Het
Dnah6	G	A	6: 73,027,514	T3822I	probably benign	Het
Dnmt1	T	A	9: 20,908,600	M1535L	probably benign	Het
Edc4	T	C	8: 105,890,419		probably null	Het
Emilin2	A	G	17: 71,274,234	I499T	possibly damaging	Het
Etl4	A	G	2: 20,781,891	D766G	probably damaging	Het
Fes	T	C	7: 80,382,392	Q414R	probably benign	Het
Fhod1	A	G	8: 105,331,440	V844A	probably benign	Het
Fshr	A	T	17: 89,046,675	V85E	probably benign	Het
Gc	T	C	5: 89,445,377	N61S	probably benign	Het
Gm13089	G	A	4: 143,697,286	P311L	possibly damaging	Het
Gm28710	T	C	5: 16,801,661		probably null	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Itga1	A	T	13: 114,968,461	I1059N	possibly damaging	Het
Itpr3	T	A	17: 27,107,662	V1426E	probably damaging	Het
Jag1	T	A	2: 137,087,124	Y804F	probably benign	Het
Lama3	A	G	18: 12,472,240	T1084A	probably benign	Het
Mdn1	A	G	4: 32,760,791	D4952G	probably benign	Het
Mmrn1	A	G	6: 60,976,876	T714A	probably damaging	Het
Nab1	T	A	1: 52,490,366	H124L	possibly damaging	Het
Nacc2	A	G	2: 26,090,106	F106S	probably damaging	Het
Nbeal1	T	C	1: 60,281,266	I2006T	probably damaging	Het
Nkpd1	C	A	7: 19,523,758	H487Q	probably benign	Het
Nop2	G	A	6: 125,140,880		probably null	Het
Olfr1116	T	A	2: 87,269,711	M310K	probably benign	Het
Olfr1489	A	G	19: 13,633,231	N40S	probably damaging	Het
Otud6b	A	T	4: 14,811,712	Y310*	probably null	Het
Phyh	A	T	2: 4,927,436	Y111F	probably benign	Het
Pon3	A	G	6: 5,240,863	L106P	probably benign	Het
Ppp6r3	T	C	19: 3,469,748	D615G	probably damaging	Het
Prdm10	G	A	9: 31,357,142	V796I	probably damaging	Het
Prkdc	G	T	16: 15,705,289	V1192F	probably damaging	Het
R3hdm2	T	G	10: 127,457,652	S142A	probably damaging	Het
Rab39	T	C	9: 53,686,365	N200S	probably benign	Het
Rcc2	A	G	4: 140,718,353	I441V	probably benign	Het
Rxra	G	A	2: 27,737,484	V72I	possibly damaging	Het
Ryr1	T	G	7: 29,095,099	Q1252P	probably benign	Het
Sectm1a	T	C	11: 121,069,647	Y114C	probably damaging	Het
Smim1	T	C	4: 154,023,819		probably null	Het
Smpd2	C	T	10: 41,487,565	D301N	probably benign	Het
Smyd3	T	C	1: 179,405,398	D139G	probably benign	Het
Sox13	C	T	1: 133,386,005	C399Y	probably damaging	Het
Tarsl2	A	G	7: 65,652,265	E179G	probably benign	Het
Tas2r138	A	G	6: 40,612,560	F251L	probably damaging	Het
Tesk1	A	G	4: 43,447,307	E565G	probably damaging	Het
Tm2d1	A	T	4: 98,357,963	F201I	possibly damaging	Het
Tom1l2	C	A	11: 60,230,116	D501Y	probably benign	Het
Trim39	G	T	17: 36,268,775	T96K	probably benign	Het
Ubash3a	A	G	17: 31,217,997	H196R	probably damaging	Het
Usp17lc	A	T	7: 103,418,898	T467S	probably benign	Het
Vmn1r128	T	C	7: 21,349,391	S7P	possibly damaging	Het
Vmn1r185	T	A	7: 26,611,648	H144L	possibly damaging	Het
Wfdc6b	A	T	2: 164,613,788	R12S	possibly damaging	Het
Zmynd8	A	T	2: 165,840,085	D175E	probably benign	Het

Other mutations in Unc13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Unc13b	APN	4	43240285	missense	probably damaging	1.00
IGL00832:Unc13b	APN	4	43258921	missense	probably damaging	1.00
IGL01111:Unc13b	APN	4	43096927	missense	possibly damaging	0.76
IGL01115:Unc13b	APN	4	43258492	missense	probably damaging	1.00
IGL01137:Unc13b	APN	4	43091291	missense	probably damaging	1.00
IGL01637:Unc13b	APN	4	43241066	missense	probably damaging	1.00
IGL01789:Unc13b	APN	4	43239462	missense	probably damaging	1.00
IGL01792:Unc13b	APN	4	43250218	missense	probably damaging	0.99
IGL01877:Unc13b	APN	4	43249583	critical splice donor site	probably null
IGL01924:Unc13b	APN	4	43239385	nonsense	probably null
IGL02087:Unc13b	APN	4	43091270	missense	probably null	1.00
IGL02197:Unc13b	APN	4	43165828	missense	probably damaging	0.99
IGL02504:Unc13b	APN	4	43263031	missense	probably damaging	1.00
IGL02659:Unc13b	APN	4	43235332	missense	probably damaging	1.00
IGL03031:Unc13b	APN	4	43235368	missense	probably damaging	1.00
IGL03036:Unc13b	APN	4	43235249	missense	probably damaging	1.00
IGL03209:Unc13b	APN	4	43239351	missense	probably damaging	0.99
IGL03352:Unc13b	APN	4	43237110	missense	possibly damaging	0.90
BB006:Unc13b	UTSW	4	43174399	missense	unknown
BB016:Unc13b	UTSW	4	43174399	missense	unknown
G1Funyon:Unc13b	UTSW	4	43263568	missense	probably benign
P0028:Unc13b	UTSW	4	43256225	missense	probably damaging	1.00
PIT4585001:Unc13b	UTSW	4	43091298	missense	probably benign	0.03
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0335:Unc13b	UTSW	4	43236983	missense	possibly damaging	0.95
R0504:Unc13b	UTSW	4	43263559	missense	probably damaging	0.99
R0631:Unc13b	UTSW	4	43182849	missense	possibly damaging	0.47
R0748:Unc13b	UTSW	4	43241164	splice site	probably benign
R1275:Unc13b	UTSW	4	43235366	missense	probably damaging	1.00
R1293:Unc13b	UTSW	4	43235190	missense	probably damaging	1.00
R1434:Unc13b	UTSW	4	43239385	nonsense	probably null
R1552:Unc13b	UTSW	4	43237144	missense	probably damaging	0.99
R1591:Unc13b	UTSW	4	43244747	missense	probably damaging	1.00
R1628:Unc13b	UTSW	4	43263371	missense	probably damaging	1.00
R1740:Unc13b	UTSW	4	43240285	missense	probably damaging	1.00
R1839:Unc13b	UTSW	4	43258308	splice site	probably benign
R2045:Unc13b	UTSW	4	43091266	missense	probably damaging	1.00
R2191:Unc13b	UTSW	4	43245566	nonsense	probably null
R2259:Unc13b	UTSW	4	43182780	missense	possibly damaging	0.87
R2307:Unc13b	UTSW	4	43239854	missense	probably damaging	0.98
R2317:Unc13b	UTSW	4	43245514	missense	probably damaging	1.00
R2402:Unc13b	UTSW	4	43095843	missense	probably benign
R2847:Unc13b	UTSW	4	43180404	missense	probably benign	0.04
R3414:Unc13b	UTSW	4	43234658	splice site	probably benign
R3436:Unc13b	UTSW	4	43097028	splice site	probably benign
R3955:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R3957:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R4015:Unc13b	UTSW	4	43237801	missense	probably damaging	1.00
R4650:Unc13b	UTSW	4	43261035	missense	probably damaging	0.97
R4836:Unc13b	UTSW	4	43237137	missense	probably damaging	1.00
R5041:Unc13b	UTSW	4	43237836	missense	probably benign	0.41
R5413:Unc13b	UTSW	4	43257936	critical splice donor site	probably null
R5994:Unc13b	UTSW	4	43172596	intron	probably benign
R6015:Unc13b	UTSW	4	43177995	nonsense	probably null
R6090:Unc13b	UTSW	4	43239306	missense	probably damaging	1.00
R6242:Unc13b	UTSW	4	43165800	missense	possibly damaging	0.92
R6246:Unc13b	UTSW	4	43216246	missense	probably benign	0.18
R6427:Unc13b	UTSW	4	43176966	unclassified	probably benign
R6660:Unc13b	UTSW	4	43177412	unclassified	probably benign
R6670:Unc13b	UTSW	4	43255562	missense	probably damaging	0.99
R6753:Unc13b	UTSW	4	43239331	missense	probably damaging	1.00
R6858:Unc13b	UTSW	4	43165828	missense	possibly damaging	0.85
R6886:Unc13b	UTSW	4	43170156	intron	probably benign
R6969:Unc13b	UTSW	4	43263538	missense	possibly damaging	0.94
R6994:Unc13b	UTSW	4	43171403	intron	probably benign
R6994:Unc13b	UTSW	4	43173203	intron	probably benign
R7080:Unc13b	UTSW	4	43171926	missense	unknown
R7117:Unc13b	UTSW	4	43216544	missense	probably benign	0.33
R7132:Unc13b	UTSW	4	43215757	missense	probably benign	0.17
R7181:Unc13b	UTSW	4	43258893	missense	probably damaging	0.99
R7192:Unc13b	UTSW	4	43258519	missense	probably damaging	1.00
R7246:Unc13b	UTSW	4	43172910	missense	unknown
R7342:Unc13b	UTSW	4	43258703	missense	probably damaging	0.99
R7345:Unc13b	UTSW	4	43173966	missense	unknown
R7355:Unc13b	UTSW	4	43237754	missense	probably damaging	1.00
R7391:Unc13b	UTSW	4	43216459	missense	probably benign	0.03
R7419:Unc13b	UTSW	4	43174023	missense	unknown
R7424:Unc13b	UTSW	4	43172235	missense	unknown
R7517:Unc13b	UTSW	4	43215765	missense	probably benign
R7532:Unc13b	UTSW	4	43249565	missense	probably benign	0.44
R7564:Unc13b	UTSW	4	43091258	missense	probably damaging	1.00
R7598:Unc13b	UTSW	4	43263569	missense	probably benign	0.20
R7604:Unc13b	UTSW	4	43170102	missense	unknown
R7604:Unc13b	UTSW	4	43256776	missense	possibly damaging	0.95
R7643:Unc13b	UTSW	4	43216333	missense	probably benign
R7718:Unc13b	UTSW	4	43173854	missense	unknown
R7735:Unc13b	UTSW	4	43165791	missense	probably damaging	1.00
R7756:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177330	small insertion	probably benign
R7757:Unc13b	UTSW	4	43177341	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177312	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177344	small insertion	probably benign
R7781:Unc13b	UTSW	4	43259546	missense	possibly damaging	0.87
R7793:Unc13b	UTSW	4	43172737	missense	unknown
R7858:Unc13b	UTSW	4	43176285	missense	unknown
R7867:Unc13b	UTSW	4	43232573	nonsense	probably null
R7897:Unc13b	UTSW	4	43171860	missense	unknown
R7904:Unc13b	UTSW	4	43217075	missense	probably benign
R7929:Unc13b	UTSW	4	43174399	missense	unknown
R7984:Unc13b	UTSW	4	43173973	missense	unknown
R8069:Unc13b	UTSW	4	43177597	missense	unknown
R8101:Unc13b	UTSW	4	43239918	missense	probably benign	0.08
R8246:Unc13b	UTSW	4	43175954	missense	unknown
R8289:Unc13b	UTSW	4	43172524	nonsense	probably null
R8301:Unc13b	UTSW	4	43263568	missense	probably benign
R8397:Unc13b	UTSW	4	43217290	missense	probably benign	0.12
R8421:Unc13b	UTSW	4	43178304	missense	unknown
R8738:Unc13b	UTSW	4	43177564	missense	unknown
R8746:Unc13b	UTSW	4	43176120	missense	unknown
R8766:Unc13b	UTSW	4	43174722	missense	unknown
R8825:Unc13b	UTSW	4	43237683	splice site	probably benign
R8834:Unc13b	UTSW	4	43175954	missense	unknown
R8862:Unc13b	UTSW	4	43235207	missense	probably damaging	1.00
R8864:Unc13b	UTSW	4	43174724	missense	unknown
R8889:Unc13b	UTSW	4	43176484	missense	unknown
R8892:Unc13b	UTSW	4	43176484	missense	unknown
R8904:Unc13b	UTSW	4	43178531	intron	probably benign
R9089:Unc13b	UTSW	4	43095847	missense	probably damaging	1.00
R9144:Unc13b	UTSW	4	43173649	missense	unknown
R9149:Unc13b	UTSW	4	43176186	missense	unknown
R9173:Unc13b	UTSW	4	43177421	missense	unknown
R9232:Unc13b	UTSW	4	43240321	missense	probably benign	0.03
R9269:Unc13b	UTSW	4	43171955	missense	unknown
R9320:Unc13b	UTSW	4	43171044	missense	unknown
R9335:Unc13b	UTSW	4	43216123	missense	possibly damaging	0.86
R9335:Unc13b	UTSW	4	43255551	missense	probably damaging	0.99
R9352:Unc13b	UTSW	4	43177312	small insertion	probably benign
R9352:Unc13b	UTSW	4	43177313	nonsense	probably null
R9378:Unc13b	UTSW	4	43173282	missense	unknown
R9382:Unc13b	UTSW	4	43172512	missense	unknown
R9569:Unc13b	UTSW	4	43177312	small deletion	probably benign
R9622:Unc13b	UTSW	4	43172513	missense
R9687:Unc13b	UTSW	4	43174920	missense	unknown
R9704:Unc13b	UTSW	4	43237102	missense	probably benign	0.31
R9721:Unc13b	UTSW	4	43101869	missense	probably benign
R9753:Unc13b	UTSW	4	43182842	nonsense	probably null
RF016:Unc13b	UTSW	4	43177347	small insertion	probably benign
RF016:Unc13b	UTSW	4	43177350	small insertion	probably benign
RF041:Unc13b	UTSW	4	43177338	small insertion	probably benign
RF056:Unc13b	UTSW	4	43177359	small insertion	probably benign
Z1176:Unc13b	UTSW	4	43171419	missense	unknown
Z1176:Unc13b	UTSW	4	43177191	missense	unknown
Z1176:Unc13b	UTSW	4	43177764	missense	unknown
Z1176:Unc13b	UTSW	4	43261043	missense	probably benign	0.11
Z1177:Unc13b	UTSW	4	43173669	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAGACTTCTCTGAATTGGCTTTAG -3'
(R):5'- AACCCAGTGGCTACTTTTCC -3'

Sequencing Primer
(F):5'- AATGTGAAGTGCCTGTAGCC -3'
(R):5'- CTTTCCAGGATTTTACCACAGTG -3'

Posted On

2022-02-07