Incidental Mutation 'R9200:Mmrn1'
ID 698161
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms 4921530G03Rik, Emilin4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9200 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 60924976-60989378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60976876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 714 (T714A)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000129603
AA Change: T714A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: T714A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204333
AA Change: T714A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: T714A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,856,034 L275P possibly damaging Het
Acsm2 C A 7: 119,580,616 Y352* probably null Het
Adh7 C T 3: 138,221,806 R38C probably benign Het
Ankrd2 A T 19: 42,040,432 T145S Het
Anpep T C 7: 79,841,122 N241D probably benign Het
Apaf1 G A 10: 91,009,240 L990F probably benign Het
Arsi A G 18: 60,916,764 T240A possibly damaging Het
Ascc3 A G 10: 50,645,691 E434G possibly damaging Het
Atp2c2 A T 8: 119,748,260 K535* probably null Het
B3galt4 A G 17: 33,951,410 probably benign Het
Brwd1 C G 16: 96,037,954 C839S probably benign Het
Cars C T 7: 143,575,917 probably null Het
Catsperd T A 17: 56,628,229 V14D unknown Het
Ccdc150 A C 1: 54,260,038 T58P probably damaging Het
Cdon A G 9: 35,503,321 D1164G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cic A C 7: 25,272,515 D557A probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Dach1 G T 14: 97,828,307 R695S probably damaging Het
Ddc T C 11: 11,815,388 N428S possibly damaging Het
Dnah6 G A 6: 73,027,514 T3822I probably benign Het
Dnmt1 T A 9: 20,908,600 M1535L probably benign Het
Edc4 T C 8: 105,890,419 probably null Het
Emilin2 A G 17: 71,274,234 I499T possibly damaging Het
Etl4 A G 2: 20,781,891 D766G probably damaging Het
Fes T C 7: 80,382,392 Q414R probably benign Het
Fhod1 A G 8: 105,331,440 V844A probably benign Het
Fshr A T 17: 89,046,675 V85E probably benign Het
Gc T C 5: 89,445,377 N61S probably benign Het
Gm13089 G A 4: 143,697,286 P311L possibly damaging Het
Gm28710 T C 5: 16,801,661 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itga1 A T 13: 114,968,461 I1059N possibly damaging Het
Itpr3 T A 17: 27,107,662 V1426E probably damaging Het
Jag1 T A 2: 137,087,124 Y804F probably benign Het
Lama3 A G 18: 12,472,240 T1084A probably benign Het
Mdn1 A G 4: 32,760,791 D4952G probably benign Het
Nab1 T A 1: 52,490,366 H124L possibly damaging Het
Nacc2 A G 2: 26,090,106 F106S probably damaging Het
Nbeal1 T C 1: 60,281,266 I2006T probably damaging Het
Nkpd1 C A 7: 19,523,758 H487Q probably benign Het
Nop2 G A 6: 125,140,880 probably null Het
Olfr1116 T A 2: 87,269,711 M310K probably benign Het
Olfr1489 A G 19: 13,633,231 N40S probably damaging Het
Otud6b A T 4: 14,811,712 Y310* probably null Het
Phyh A T 2: 4,927,436 Y111F probably benign Het
Pon3 A G 6: 5,240,863 L106P probably benign Het
Ppp6r3 T C 19: 3,469,748 D615G probably damaging Het
Prdm10 G A 9: 31,357,142 V796I probably damaging Het
Prkdc G T 16: 15,705,289 V1192F probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rab39 T C 9: 53,686,365 N200S probably benign Het
Rcc2 A G 4: 140,718,353 I441V probably benign Het
Rxra G A 2: 27,737,484 V72I possibly damaging Het
Ryr1 T G 7: 29,095,099 Q1252P probably benign Het
Sectm1a T C 11: 121,069,647 Y114C probably damaging Het
Smim1 T C 4: 154,023,819 probably null Het
Smpd2 C T 10: 41,487,565 D301N probably benign Het
Smyd3 T C 1: 179,405,398 D139G probably benign Het
Sox13 C T 1: 133,386,005 C399Y probably damaging Het
Tarsl2 A G 7: 65,652,265 E179G probably benign Het
Tas2r138 A G 6: 40,612,560 F251L probably damaging Het
Tesk1 A G 4: 43,447,307 E565G probably damaging Het
Tm2d1 A T 4: 98,357,963 F201I possibly damaging Het
Tom1l2 C A 11: 60,230,116 D501Y probably benign Het
Trim39 G T 17: 36,268,775 T96K probably benign Het
Ubash3a A G 17: 31,217,997 H196R probably damaging Het
Unc13b A G 4: 43,257,352 E1206G possibly damaging Het
Usp17lc A T 7: 103,418,898 T467S probably benign Het
Vmn1r128 T C 7: 21,349,391 S7P possibly damaging Het
Vmn1r185 T A 7: 26,611,648 H144L possibly damaging Het
Wfdc6b A T 2: 164,613,788 R12S possibly damaging Het
Zmynd8 A T 2: 165,840,085 D175E probably benign Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60988396 missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60987209 missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60988287 missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60976529 missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60976093 missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60976058 missense probably benign 0.04
R9287:Mmrn1 UTSW 6 60975955 missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60958192 nonsense probably null
R9612:Mmrn1 UTSW 6 60976424 missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60971088 nonsense probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCGCAGAGAGCTACAAAACCTG -3'
(R):5'- CGCTGTAAGGGCTTTAGCAATTTG -3'

Sequencing Primer
(F):5'- TGATCGGTGCCATCAACC -3'
(R):5'- TCTCTTTGTTATTGACCAAAGTCTG -3'
Posted On 2022-02-07