Incidental Mutation 'R9200:Atp2c2'
ID 698177
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 068957-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9200 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 120474999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 535 (K535*)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably null
Transcript: ENSMUST00000095171
AA Change: K535*
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: K535*

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 C A 7: 119,179,839 (GRCm39) Y352* probably null Het
Adh7 C T 3: 137,927,567 (GRCm39) R38C probably benign Het
Ankrd2 A T 19: 42,028,871 (GRCm39) T145S Het
Anpep T C 7: 79,490,870 (GRCm39) N241D probably benign Het
Apaf1 G A 10: 90,845,102 (GRCm39) L990F probably benign Het
Arsi A G 18: 61,049,836 (GRCm39) T240A possibly damaging Het
Ascc3 A G 10: 50,521,787 (GRCm39) E434G possibly damaging Het
B3galt4 A G 17: 34,170,384 (GRCm39) probably benign Het
Brwd1 C G 16: 95,839,154 (GRCm39) C839S probably benign Het
Cars1 C T 7: 143,129,654 (GRCm39) probably null Het
Catsperd T A 17: 56,935,229 (GRCm39) V14D unknown Het
Ccdc150 A C 1: 54,299,197 (GRCm39) T58P probably damaging Het
Cdhr17 T C 5: 17,006,659 (GRCm39) probably null Het
Cdon A G 9: 35,414,617 (GRCm39) D1164G probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cic A C 7: 24,971,940 (GRCm39) D557A probably damaging Het
Clip4 G A 17: 72,117,884 (GRCm39) G310R probably damaging Het
Dach1 G T 14: 98,065,743 (GRCm39) R695S probably damaging Het
Ddc T C 11: 11,765,388 (GRCm39) N428S possibly damaging Het
Dnah6 G A 6: 73,004,497 (GRCm39) T3822I probably benign Het
Dnmt1 T A 9: 20,819,896 (GRCm39) M1535L probably benign Het
Edc4 T C 8: 106,617,051 (GRCm39) probably null Het
Emilin2 A G 17: 71,581,229 (GRCm39) I499T possibly damaging Het
Etl4 A G 2: 20,786,702 (GRCm39) D766G probably damaging Het
Fes T C 7: 80,032,140 (GRCm39) Q414R probably benign Het
Fhod1 A G 8: 106,058,072 (GRCm39) V844A probably benign Het
Fshr A T 17: 89,354,103 (GRCm39) V85E probably benign Het
Gc T C 5: 89,593,236 (GRCm39) N61S probably benign Het
Hapstr1 T C 16: 8,673,898 (GRCm39) L275P possibly damaging Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Itga1 A T 13: 115,104,997 (GRCm39) I1059N possibly damaging Het
Itpr3 T A 17: 27,326,636 (GRCm39) V1426E probably damaging Het
Jag1 T A 2: 136,929,044 (GRCm39) Y804F probably benign Het
Lama3 A G 18: 12,605,297 (GRCm39) T1084A probably benign Het
Mdn1 A G 4: 32,760,791 (GRCm39) D4952G probably benign Het
Mmrn1 A G 6: 60,953,860 (GRCm39) T714A probably damaging Het
Nab1 T A 1: 52,529,525 (GRCm39) H124L possibly damaging Het
Nacc2 A G 2: 25,980,118 (GRCm39) F106S probably damaging Het
Nbeal1 T C 1: 60,320,425 (GRCm39) I2006T probably damaging Het
Nkpd1 C A 7: 19,257,683 (GRCm39) H487Q probably benign Het
Nop2 G A 6: 125,117,843 (GRCm39) probably null Het
Or10ag54 T A 2: 87,100,055 (GRCm39) M310K probably benign Het
Or5b124 A G 19: 13,610,595 (GRCm39) N40S probably damaging Het
Otud6b A T 4: 14,811,712 (GRCm39) Y310* probably null Het
Phyh A T 2: 4,932,247 (GRCm39) Y111F probably benign Het
Pon3 A G 6: 5,240,863 (GRCm39) L106P probably benign Het
Ppp6r3 T C 19: 3,519,748 (GRCm39) D615G probably damaging Het
Pramel23 G A 4: 143,423,856 (GRCm39) P311L possibly damaging Het
Prdm10 G A 9: 31,268,438 (GRCm39) V796I probably damaging Het
Prkdc G T 16: 15,523,153 (GRCm39) V1192F probably damaging Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rab39 T C 9: 53,597,665 (GRCm39) N200S probably benign Het
Rcc2 A G 4: 140,445,664 (GRCm39) I441V probably benign Het
Rxra G A 2: 27,627,496 (GRCm39) V72I possibly damaging Het
Ryr1 T G 7: 28,794,524 (GRCm39) Q1252P probably benign Het
Sectm1a T C 11: 120,960,473 (GRCm39) Y114C probably damaging Het
Smim1 T C 4: 154,108,276 (GRCm39) probably null Het
Smpd2 C T 10: 41,363,561 (GRCm39) D301N probably benign Het
Smyd3 T C 1: 179,232,963 (GRCm39) D139G probably benign Het
Sox13 C T 1: 133,313,743 (GRCm39) C399Y probably damaging Het
Tars3 A G 7: 65,302,013 (GRCm39) E179G probably benign Het
Tas2r138 A G 6: 40,589,494 (GRCm39) F251L probably damaging Het
Tesk1 A G 4: 43,447,307 (GRCm39) E565G probably damaging Het
Tm2d1 A T 4: 98,246,200 (GRCm39) F201I possibly damaging Het
Tom1l2 C A 11: 60,120,942 (GRCm39) D501Y probably benign Het
Trim39 G T 17: 36,579,667 (GRCm39) T96K probably benign Het
Ubash3a A G 17: 31,436,971 (GRCm39) H196R probably damaging Het
Unc13b A G 4: 43,257,352 (GRCm39) E1206G possibly damaging Het
Usp17lc A T 7: 103,068,105 (GRCm39) T467S probably benign Het
Vmn1r128 T C 7: 21,083,316 (GRCm39) S7P possibly damaging Het
Vmn1r185 T A 7: 26,311,073 (GRCm39) H144L possibly damaging Het
Wfdc6b A T 2: 164,455,708 (GRCm39) R12S possibly damaging Het
Zmynd8 A T 2: 165,682,005 (GRCm39) D175E probably benign Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGTCCAGGTGTAGACCCG -3'
(R):5'- ACTAGACGGTCCATCCTGAC -3'

Sequencing Primer
(F):5'- CTCTAGTATGAGGCAGCTGTC -3'
(R):5'- GGTCCATCCTGACTGTGAAG -3'
Posted On 2022-02-07