Incidental Mutation 'R9200:Atp2c2'
ID 698177
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9200 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 119700009-119757717 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 119748260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 535 (K535*)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably null
Transcript: ENSMUST00000095171
AA Change: K535*
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: K535*

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,856,034 L275P possibly damaging Het
Acsm2 C A 7: 119,580,616 Y352* probably null Het
Adh7 C T 3: 138,221,806 R38C probably benign Het
Ankrd2 A T 19: 42,040,432 T145S Het
Anpep T C 7: 79,841,122 N241D probably benign Het
Apaf1 G A 10: 91,009,240 L990F probably benign Het
Arsi A G 18: 60,916,764 T240A possibly damaging Het
Ascc3 A G 10: 50,645,691 E434G possibly damaging Het
B3galt4 A G 17: 33,951,410 probably benign Het
Brwd1 C G 16: 96,037,954 C839S probably benign Het
Cars C T 7: 143,575,917 probably null Het
Catsperd T A 17: 56,628,229 V14D unknown Het
Ccdc150 A C 1: 54,260,038 T58P probably damaging Het
Cdon A G 9: 35,503,321 D1164G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cic A C 7: 25,272,515 D557A probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Dach1 G T 14: 97,828,307 R695S probably damaging Het
Ddc T C 11: 11,815,388 N428S possibly damaging Het
Dnah6 G A 6: 73,027,514 T3822I probably benign Het
Dnmt1 T A 9: 20,908,600 M1535L probably benign Het
Edc4 T C 8: 105,890,419 probably null Het
Emilin2 A G 17: 71,274,234 I499T possibly damaging Het
Etl4 A G 2: 20,781,891 D766G probably damaging Het
Fes T C 7: 80,382,392 Q414R probably benign Het
Fhod1 A G 8: 105,331,440 V844A probably benign Het
Fshr A T 17: 89,046,675 V85E probably benign Het
Gc T C 5: 89,445,377 N61S probably benign Het
Gm13089 G A 4: 143,697,286 P311L possibly damaging Het
Gm28710 T C 5: 16,801,661 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itga1 A T 13: 114,968,461 I1059N possibly damaging Het
Itpr3 T A 17: 27,107,662 V1426E probably damaging Het
Jag1 T A 2: 137,087,124 Y804F probably benign Het
Lama3 A G 18: 12,472,240 T1084A probably benign Het
Mdn1 A G 4: 32,760,791 D4952G probably benign Het
Mmrn1 A G 6: 60,976,876 T714A probably damaging Het
Nab1 T A 1: 52,490,366 H124L possibly damaging Het
Nacc2 A G 2: 26,090,106 F106S probably damaging Het
Nbeal1 T C 1: 60,281,266 I2006T probably damaging Het
Nkpd1 C A 7: 19,523,758 H487Q probably benign Het
Nop2 G A 6: 125,140,880 probably null Het
Olfr1116 T A 2: 87,269,711 M310K probably benign Het
Olfr1489 A G 19: 13,633,231 N40S probably damaging Het
Otud6b A T 4: 14,811,712 Y310* probably null Het
Phyh A T 2: 4,927,436 Y111F probably benign Het
Pon3 A G 6: 5,240,863 L106P probably benign Het
Ppp6r3 T C 19: 3,469,748 D615G probably damaging Het
Prdm10 G A 9: 31,357,142 V796I probably damaging Het
Prkdc G T 16: 15,705,289 V1192F probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rab39 T C 9: 53,686,365 N200S probably benign Het
Rcc2 A G 4: 140,718,353 I441V probably benign Het
Rxra G A 2: 27,737,484 V72I possibly damaging Het
Ryr1 T G 7: 29,095,099 Q1252P probably benign Het
Sectm1a T C 11: 121,069,647 Y114C probably damaging Het
Smim1 T C 4: 154,023,819 probably null Het
Smpd2 C T 10: 41,487,565 D301N probably benign Het
Smyd3 T C 1: 179,405,398 D139G probably benign Het
Sox13 C T 1: 133,386,005 C399Y probably damaging Het
Tarsl2 A G 7: 65,652,265 E179G probably benign Het
Tas2r138 A G 6: 40,612,560 F251L probably damaging Het
Tesk1 A G 4: 43,447,307 E565G probably damaging Het
Tm2d1 A T 4: 98,357,963 F201I possibly damaging Het
Tom1l2 C A 11: 60,230,116 D501Y probably benign Het
Trim39 G T 17: 36,268,775 T96K probably benign Het
Ubash3a A G 17: 31,217,997 H196R probably damaging Het
Unc13b A G 4: 43,257,352 E1206G possibly damaging Het
Usp17lc A T 7: 103,418,898 T467S probably benign Het
Vmn1r128 T C 7: 21,349,391 S7P possibly damaging Het
Vmn1r185 T A 7: 26,611,648 H144L possibly damaging Het
Wfdc6b A T 2: 164,613,788 R12S possibly damaging Het
Zmynd8 A T 2: 165,840,085 D175E probably benign Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 119745590 missense probably benign
IGL01624:Atp2c2 APN 8 119757450 missense probably benign 0.00
IGL02133:Atp2c2 APN 8 119754335 missense probably benign 0.00
IGL02221:Atp2c2 APN 8 119744334 missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 119730274 missense probably benign
IGL02657:Atp2c2 APN 8 119753032 missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 119749120 missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 119742675 missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 119749062 missense probably benign 0.15
R0372:Atp2c2 UTSW 8 119757441 missense probably benign
R0502:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0503:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0584:Atp2c2 UTSW 8 119738418 missense probably benign 0.01
R1225:Atp2c2 UTSW 8 119735245 missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 119752987 missense probably benign 0.00
R1620:Atp2c2 UTSW 8 119749126 missense probably benign
R1638:Atp2c2 UTSW 8 119756003 missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 119725094 missense probably benign 0.02
R1746:Atp2c2 UTSW 8 119734443 unclassified probably benign
R1907:Atp2c2 UTSW 8 119749876 splice site probably benign
R2104:Atp2c2 UTSW 8 119749845 missense probably benign
R2151:Atp2c2 UTSW 8 119756102 missense probably benign
R2152:Atp2c2 UTSW 8 119756102 missense probably benign
R2154:Atp2c2 UTSW 8 119756102 missense probably benign
R2207:Atp2c2 UTSW 8 119748309 missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 119735296 missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 119721276 missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 119749871 critical splice donor site probably null
R4782:Atp2c2 UTSW 8 119749152 missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 119747687 missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 119754263 missense probably benign 0.00
R5485:Atp2c2 UTSW 8 119753062 critical splice donor site probably null
R5978:Atp2c2 UTSW 8 119749875 splice site probably null
R6377:Atp2c2 UTSW 8 119726354 missense probably benign 0.10
R6613:Atp2c2 UTSW 8 119756021 missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 119753017 missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 119734415 missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 119730267 nonsense probably null
R7220:Atp2c2 UTSW 8 119745561 missense probably benign 0.00
R7238:Atp2c2 UTSW 8 119742421 missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 119730252 missense probably benign 0.02
R7438:Atp2c2 UTSW 8 119748197 missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 119751269 missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 119748176 missense probably benign 0.00
R7737:Atp2c2 UTSW 8 119742395 missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 119730178 missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 119749294 splice site probably null
R8831:Atp2c2 UTSW 8 119749294 splice site probably null
R9211:Atp2c2 UTSW 8 119719293 missense probably benign
R9246:Atp2c2 UTSW 8 119730250 missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 119738402 missense probably benign 0.00
RF004:Atp2c2 UTSW 8 119752822 missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 119745514 missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 119734385 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGTCCAGGTGTAGACCCG -3'
(R):5'- ACTAGACGGTCCATCCTGAC -3'

Sequencing Primer
(F):5'- CTCTAGTATGAGGCAGCTGTC -3'
(R):5'- GGTCCATCCTGACTGTGAAG -3'
Posted On 2022-02-07