Incidental Mutation 'R9200:Arsi'
ID 698204
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Name arylsulfatase i
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9200 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 60911780-60918561 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60916764 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
AlphaFold Q32KI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000040359
AA Change: T240A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: T240A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,856,034 L275P possibly damaging Het
Acsm2 C A 7: 119,580,616 Y352* probably null Het
Adh7 C T 3: 138,221,806 R38C probably benign Het
Ankrd2 A T 19: 42,040,432 T145S Het
Anpep T C 7: 79,841,122 N241D probably benign Het
Apaf1 G A 10: 91,009,240 L990F probably benign Het
Ascc3 A G 10: 50,645,691 E434G possibly damaging Het
Atp2c2 A T 8: 119,748,260 K535* probably null Het
B3galt4 A G 17: 33,951,410 probably benign Het
Brwd1 C G 16: 96,037,954 C839S probably benign Het
Cars C T 7: 143,575,917 probably null Het
Catsperd T A 17: 56,628,229 V14D unknown Het
Ccdc150 A C 1: 54,260,038 T58P probably damaging Het
Cdon A G 9: 35,503,321 D1164G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cic A C 7: 25,272,515 D557A probably damaging Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Dach1 G T 14: 97,828,307 R695S probably damaging Het
Ddc T C 11: 11,815,388 N428S possibly damaging Het
Dnah6 G A 6: 73,027,514 T3822I probably benign Het
Dnmt1 T A 9: 20,908,600 M1535L probably benign Het
Edc4 T C 8: 105,890,419 probably null Het
Emilin2 A G 17: 71,274,234 I499T possibly damaging Het
Etl4 A G 2: 20,781,891 D766G probably damaging Het
Fes T C 7: 80,382,392 Q414R probably benign Het
Fhod1 A G 8: 105,331,440 V844A probably benign Het
Fshr A T 17: 89,046,675 V85E probably benign Het
Gc T C 5: 89,445,377 N61S probably benign Het
Gm13089 G A 4: 143,697,286 P311L possibly damaging Het
Gm28710 T C 5: 16,801,661 probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itga1 A T 13: 114,968,461 I1059N possibly damaging Het
Itpr3 T A 17: 27,107,662 V1426E probably damaging Het
Jag1 T A 2: 137,087,124 Y804F probably benign Het
Lama3 A G 18: 12,472,240 T1084A probably benign Het
Mdn1 A G 4: 32,760,791 D4952G probably benign Het
Mmrn1 A G 6: 60,976,876 T714A probably damaging Het
Nab1 T A 1: 52,490,366 H124L possibly damaging Het
Nacc2 A G 2: 26,090,106 F106S probably damaging Het
Nbeal1 T C 1: 60,281,266 I2006T probably damaging Het
Nkpd1 C A 7: 19,523,758 H487Q probably benign Het
Nop2 G A 6: 125,140,880 probably null Het
Olfr1116 T A 2: 87,269,711 M310K probably benign Het
Olfr1489 A G 19: 13,633,231 N40S probably damaging Het
Otud6b A T 4: 14,811,712 Y310* probably null Het
Phyh A T 2: 4,927,436 Y111F probably benign Het
Pon3 A G 6: 5,240,863 L106P probably benign Het
Ppp6r3 T C 19: 3,469,748 D615G probably damaging Het
Prdm10 G A 9: 31,357,142 V796I probably damaging Het
Prkdc G T 16: 15,705,289 V1192F probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rab39 T C 9: 53,686,365 N200S probably benign Het
Rcc2 A G 4: 140,718,353 I441V probably benign Het
Rxra G A 2: 27,737,484 V72I possibly damaging Het
Ryr1 T G 7: 29,095,099 Q1252P probably benign Het
Sectm1a T C 11: 121,069,647 Y114C probably damaging Het
Smim1 T C 4: 154,023,819 probably null Het
Smpd2 C T 10: 41,487,565 D301N probably benign Het
Smyd3 T C 1: 179,405,398 D139G probably benign Het
Sox13 C T 1: 133,386,005 C399Y probably damaging Het
Tarsl2 A G 7: 65,652,265 E179G probably benign Het
Tas2r138 A G 6: 40,612,560 F251L probably damaging Het
Tesk1 A G 4: 43,447,307 E565G probably damaging Het
Tm2d1 A T 4: 98,357,963 F201I possibly damaging Het
Tom1l2 C A 11: 60,230,116 D501Y probably benign Het
Trim39 G T 17: 36,268,775 T96K probably benign Het
Ubash3a A G 17: 31,217,997 H196R probably damaging Het
Unc13b A G 4: 43,257,352 E1206G possibly damaging Het
Usp17lc A T 7: 103,418,898 T467S probably benign Het
Vmn1r128 T C 7: 21,349,391 S7P possibly damaging Het
Vmn1r185 T A 7: 26,611,648 H144L possibly damaging Het
Wfdc6b A T 2: 164,613,788 R12S possibly damaging Het
Zmynd8 A T 2: 165,840,085 D175E probably benign Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1641:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2484:Arsi UTSW 18 60916651 missense probably benign 0.07
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2995:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3884:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4212:Arsi UTSW 18 60916701 missense probably damaging 1.00
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4459:Arsi UTSW 18 60916651 missense probably benign 0.07
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
R7813:Arsi UTSW 18 60916654 missense possibly damaging 0.58
R7974:Arsi UTSW 18 60912406 missense probably damaging 1.00
R8035:Arsi UTSW 18 60916370 missense probably damaging 1.00
R9162:Arsi UTSW 18 60917497 missense probably damaging 0.96
R9581:Arsi UTSW 18 60917088 missense probably damaging 1.00
Z1176:Arsi UTSW 18 60916780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACGACAACTGTGATGGCC -3'
(R):5'- AGTAAGTACCCTTGCGTCCTC -3'

Sequencing Primer
(F):5'- ACAACTGTGATGGCCCAGGG -3'
(R):5'- GCCACCATTGTCACTGGAGAAG -3'
Posted On 2022-02-07