Incidental Mutation 'R9202:Insrr'
ID 698263
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R9202 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 87796951-87816101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 87813120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1022 (R1022W)
Ref Sequence ENSEMBL: ENSMUSP00000029711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: R1022W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: R1022W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: R1022W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: R1022W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,890,821 S310G probably benign Het
Alpk1 A T 3: 127,686,289 I17K Het
Ampd3 T C 7: 110,803,139 I441T probably damaging Het
Ankrd31 C T 13: 96,878,875 Q1551* probably null Het
Asphd1 T A 7: 126,948,762 Y123F probably damaging Het
Atf2 A G 2: 73,819,128 S380P probably damaging Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cep72 G T 13: 74,050,301 T320K probably benign Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Ctnna3 T G 10: 64,873,168 M662R probably damaging Het
Flvcr1 T A 1: 191,012,154 Y399F probably benign Het
Gimap8 T A 6: 48,656,469 F407L probably benign Het
Gm12794 A G 4: 101,940,663 D86G probably damaging Het
Ipo4 A T 14: 55,631,140 probably null Het
Klhl35 A G 7: 99,471,005 N363S probably benign Het
Loxl4 T C 19: 42,605,013 T240A probably benign Het
Med23 T C 10: 24,904,304 V950A probably benign Het
Nceh1 A G 3: 27,279,279 I175V probably benign Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Olfr1030 T A 2: 85,984,457 F206I probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr206 T C 16: 59,345,255 I149V probably benign Het
Osbpl5 T C 7: 143,700,761 D515G probably benign Het
Pafah2 T C 4: 134,404,129 S68P probably benign Het
Pcnx2 T A 8: 125,889,677 probably null Het
Pde11a G T 2: 76,022,733 S847* probably null Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Ripk2 C A 4: 16,124,502 G402V probably benign Het
Speg T C 1: 75,390,993 S715P probably damaging Het
Ttll12 A G 15: 83,582,063 F399S probably damaging Het
Ugt1a2 G T 1: 88,200,653 C6F probably benign Het
Vars2 T C 17: 35,663,552 probably null Het
Vars2 T C 17: 35,666,659 Y127C probably damaging Het
Vmn2r95 T C 17: 18,424,132 F10S probably benign Het
Wdr12 T C 1: 60,082,046 D371G possibly damaging Het
Wdr89 C T 12: 75,633,169 E104K probably benign Het
Zbtb1 G T 12: 76,387,010 R590L probably damaging Het
Zfhx3 A G 8: 108,951,288 D2990G possibly damaging Het
Zfp710 G A 7: 80,081,861 G262D probably damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 splice site probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 splice site probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 splice site probably null
R5685:Insrr UTSW 3 87800496 splice site probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7473:Insrr UTSW 3 87804531 splice site probably null
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
R8159:Insrr UTSW 3 87800428 missense probably damaging 1.00
R8289:Insrr UTSW 3 87814194 missense probably damaging 1.00
R8309:Insrr UTSW 3 87810442 missense probably benign 0.00
R8312:Insrr UTSW 3 87800484 missense possibly damaging 0.93
R8445:Insrr UTSW 3 87813584 missense probably damaging 1.00
R8917:Insrr UTSW 3 87810969 missense probably benign 0.00
R8960:Insrr UTSW 3 87813079 missense probably damaging 1.00
R8989:Insrr UTSW 3 87815357 missense probably damaging 0.96
R9015:Insrr UTSW 3 87813603 missense probably damaging 1.00
R9251:Insrr UTSW 3 87810084 missense probably benign 0.08
R9327:Insrr UTSW 3 87814297 missense probably damaging 1.00
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87800827 missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87802579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGTGTATGTCCCCGACG -3'
(R):5'- ATGACGTGCTCACCTCTGAC -3'

Sequencing Primer
(F):5'- TGTATGTCCCCGACGAGTGG -3'
(R):5'- TGGATACCCAGTGCTGTACC -3'
Posted On 2022-02-07