Mutagenetix > Incidental Mutation

Incidental Mutation 'R9202:Med23'

698278

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9202 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24904304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 950 (V950A)

Ref Sequence

ENSEMBL: ENSMUSP00000090316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020159
AA Change: V944A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: V944A

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092646
AA Change: V950A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: V950A

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176285
AA Change: V584A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: V584A

Domain	Start	End	E-Value	Type
Pfam:Med23	1	51	4.4e-14	PFAM
Pfam:Med23	48	950	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177232

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,890,821	S310G	probably benign	Het
Alpk1	A	T	3: 127,686,289	I17K		Het
Ampd3	T	C	7: 110,803,139	I441T	probably damaging	Het
Ankrd31	C	T	13: 96,878,875	Q1551*	probably null	Het
Asphd1	T	A	7: 126,948,762	Y123F	probably damaging	Het
Atf2	A	G	2: 73,819,128	S380P	probably damaging	Het
Ccdc88b	T	C	19: 6,855,845	E278G	probably damaging	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cep72	G	T	13: 74,050,301	T320K	probably benign	Het
Clip4	G	A	17: 71,810,889	G310R	probably damaging	Het
Ctnna3	T	G	10: 64,873,168	M662R	probably damaging	Het
Cyp2r1	T	G	7: 114,552,812		probably benign	Het
Flvcr1	T	A	1: 191,012,154	Y399F	probably benign	Het
Gimap8	T	A	6: 48,656,469	F407L	probably benign	Het
Gm12794	A	G	4: 101,940,663	D86G	probably damaging	Het
Insrr	C	T	3: 87,813,120	R1022W	probably damaging	Het
Ipo4	A	T	14: 55,631,140		probably null	Het
Klhl35	A	G	7: 99,471,005	N363S	probably benign	Het
Loxl4	T	C	19: 42,605,013	T240A	probably benign	Het
Nceh1	A	G	3: 27,279,279	I175V	probably benign	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Olfr1030	T	A	2: 85,984,457	F206I	probably damaging	Het
Olfr139	A	G	11: 74,044,615	S220P	probably damaging	Het
Olfr206	T	C	16: 59,345,255	I149V	probably benign	Het
Osbpl5	T	C	7: 143,700,761	D515G	probably benign	Het
Pafah2	T	C	4: 134,404,129	S68P	probably benign	Het
Pcnx2	T	A	8: 125,889,677		probably null	Het
Pde11a	G	T	2: 76,022,733	S847*	probably null	Het
Pramef6	T	A	4: 143,897,076	N176I	probably benign	Het
Ptprq	C	T	10: 107,686,555	V546I	probably damaging	Het
R3hdm2	T	G	10: 127,457,652	S142A	probably damaging	Het
Ripk2	C	A	4: 16,124,502	G402V	probably benign	Het
Speg	T	C	1: 75,390,993	S715P	probably damaging	Het
Ttll12	A	G	15: 83,582,063	F399S	probably damaging	Het
Ugt1a2	G	T	1: 88,200,653	C6F	probably benign	Het
Vars2	T	C	17: 35,663,552		probably null	Het
Vars2	T	C	17: 35,666,659	Y127C	probably damaging	Het
Vmn2r95	T	C	17: 18,424,132	F10S	probably benign	Het
Wdr12	T	C	1: 60,082,046	D371G	possibly damaging	Het
Wdr89	C	T	12: 75,633,169	E104K	probably benign	Het
Zbtb1	G	T	12: 76,387,010	R590L	probably damaging	Het
Zfhx3	A	G	8: 108,951,288	D2990G	possibly damaging	Het
Zfp710	G	A	7: 80,081,861	G262D	probably damaging	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2309:Med23	UTSW	10	24870688	missense	probably damaging	0.99
R2507:Med23	UTSW	10	24910813	missense	probably damaging	1.00
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R4943:Med23	UTSW	10	24875669	missense	possibly damaging	0.92
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6107:Med23	UTSW	10	24906034	nonsense	probably null
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6911:Med23	UTSW	10	24902181	missense	probably damaging	0.98
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
R8975:Med23	UTSW	10	24904436	missense	probably benign	0.42
R9131:Med23	UTSW	10	24904381	missense
R9341:Med23	UTSW	10	24912807	missense	probably benign
R9342:Med23	UTSW	10	24874571	missense	probably benign	0.01
R9343:Med23	UTSW	10	24912807	missense	probably benign
R9412:Med23	UTSW	10	24902121	missense	probably damaging	1.00
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATTTAAGGAGGCATGTGC -3'
(R):5'- TACTACATGGCGTGCTCAGC -3'

Sequencing Primer
(F):5'- TGTAGATTTCTTCTTTCTCTCTCCC -3'
(R):5'- GTGCTCAGCCTATCTGTTCATAAAGG -3'

Posted On

2022-02-07