Mutagenetix > Incidental Mutations

Incidental Mutation 'R9203:Anapc1'

698301

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9203 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128623502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1686 (H1686R)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: H1686R

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: H1686R

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd33b	A	G	15: 31,297,882	M243T	probably benign	Het
Appl1	G	T	14: 26,961,013	S104*	probably null	Het
Appl2	A	T	10: 83,641,015	Y48*	probably null	Het
Cacna1d	T	C	14: 30,051,712	N1694S	probably benign	Het
Cc2d2a	G	T	5: 43,733,837	D1372Y	probably benign	Het
Cdh4	C	T	2: 179,780,403	R107C	probably damaging	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cfap54	T	G	10: 93,045,128	M358L	probably benign	Het
Csnka2ip	T	A	16: 64,478,267	D578V	unknown	Het
Ctns	T	C	11: 73,191,737	I56V	probably benign	Het
Dnah9	A	G	11: 65,855,287	I4000T	possibly damaging	Het
Dock2	A	G	11: 34,731,539	V91A	possibly damaging	Het
Dpep2	T	C	8: 105,986,253	H335R	probably damaging	Het
Eno1	C	T	4: 150,248,082	R400*	probably null	Het
Fam114a1	C	A	5: 64,979,957	P81H	probably damaging	Het
Gemin6	A	G	17: 80,227,808	T66A	probably benign	Het
Grm4	T	C	17: 27,435,006	I657V	probably benign	Het
Has3	T	C	8: 106,874,220	C105R	probably damaging	Het
Hecw1	T	C	13: 14,316,658	E170G	probably benign	Het
Hist1h2an	T	C	13: 21,786,887	N111S	probably benign	Het
Hoxd3	T	C	2: 74,746,400	V208A	probably damaging	Het
Hypk	C	T	2: 121,457,682	Q75*	probably null	Het
Itpkb	T	A	1: 180,333,439	W377R	probably benign	Het
Kbtbd2	A	T	6: 56,779,002	V583E	probably damaging	Het
Kdm5d	A	G	Y: 940,981	Y1122C	probably damaging	Het
Kif7	A	C	7: 79,704,724	L771R	probably damaging	Het
Krt9	C	G	11: 100,188,908	G553R	unknown	Het
Lama3	G	A	18: 12,462,812	A933T	probably benign	Het
Muc16	A	G	9: 18,551,688	I7406T	unknown	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Ntng2	G	T	2: 29,194,986	C535*	probably null	Het
Olfr1375	A	T	11: 51,048,334	T76S	possibly damaging	Het
Olfr594	A	T	7: 103,220,655	*312C	probably null	Het
Omg	A	G	11: 79,502,225	M269T	probably benign	Het
Parp2	T	C	14: 50,819,393	S325P	probably benign	Het
Pclo	C	T	5: 14,678,514	T2462M	unknown	Het
Pi4ka	G	T	16: 17,282,301	H1912N		Het
Piezo2	T	C	18: 63,157,231	I152M	probably benign	Het
Pigv	A	T	4: 133,665,679	L60Q	probably damaging	Het
Plcz1	T	A	6: 140,007,755	K379*	probably null	Het
Poll	T	C	19: 45,553,652	N405S	probably benign	Het
Pou6f2	T	A	13: 18,129,030	I467F		Het
Pramef6	T	A	4: 143,897,076	N176I	probably benign	Het
Psg26	T	C	7: 18,478,457	I324M	probably damaging	Het
Ptprh	T	A	7: 4,571,971	I350F	probably damaging	Het
Slpi	C	T	2: 164,354,897	V126I	probably benign	Het
Smarca5	C	T	8: 80,704,629	W986*	probably null	Het
Sorcs1	A	G	19: 50,262,295	I366T	probably damaging	Het
Sv2c	G	T	13: 96,088,237	S188*	probably null	Het
Sycp2	T	C	2: 178,355,113	K1099R	probably damaging	Het
Tdp2	C	A	13: 24,836,933	Y178*	probably null	Het
Trabd2b	A	G	4: 114,602,925	E420G	probably damaging	Het
Uggt2	A	T	14: 119,057,563	H550Q	probably benign	Het
Vmn2r66	T	C	7: 85,005,742	K453R	probably benign	Het
Vsig10l	A	G	7: 43,463,233	M1V	probably null	Het
Wdr70	G	A	15: 7,873,203	S646L	probably benign	Het
Zfp219	A	T	14: 52,008,948	S241T	probably damaging	Het
Zfp24	G	A	18: 24,014,269	H329Y	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGTACCCATTACTATCTGAGTCAG -3'
(R):5'- GGTTCACAAGCAATTGGATCTCG -3'

Sequencing Primer
(F):5'- CCCATTACTATCTGAGTCAGTTTTAG -3'
(R):5'- CACAAGCAATTGGATCTCGTTAAC -3'

Posted On

2022-02-07