Incidental Mutation 'R9203:Anapc1'
ID 698301
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms 2610021O03Rik, tsg24, Apc1, Mcpr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9203 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128610104-128687391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128623502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1686 (H1686R)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
AlphaFold P53995
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: H1686R

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: H1686R

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd33b A G 15: 31,297,882 M243T probably benign Het
Appl1 G T 14: 26,961,013 S104* probably null Het
Appl2 A T 10: 83,641,015 Y48* probably null Het
Cacna1d T C 14: 30,051,712 N1694S probably benign Het
Cc2d2a G T 5: 43,733,837 D1372Y probably benign Het
Cdh4 C T 2: 179,780,403 R107C probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cfap54 T G 10: 93,045,128 M358L probably benign Het
Csnka2ip T A 16: 64,478,267 D578V unknown Het
Ctns T C 11: 73,191,737 I56V probably benign Het
Dnah9 A G 11: 65,855,287 I4000T possibly damaging Het
Dock2 A G 11: 34,731,539 V91A possibly damaging Het
Dpep2 T C 8: 105,986,253 H335R probably damaging Het
Eno1 C T 4: 150,248,082 R400* probably null Het
Fam114a1 C A 5: 64,979,957 P81H probably damaging Het
Gemin6 A G 17: 80,227,808 T66A probably benign Het
Grm4 T C 17: 27,435,006 I657V probably benign Het
Has3 T C 8: 106,874,220 C105R probably damaging Het
Hecw1 T C 13: 14,316,658 E170G probably benign Het
Hist1h2an T C 13: 21,786,887 N111S probably benign Het
Hoxd3 T C 2: 74,746,400 V208A probably damaging Het
Hypk C T 2: 121,457,682 Q75* probably null Het
Itpkb T A 1: 180,333,439 W377R probably benign Het
Kbtbd2 A T 6: 56,779,002 V583E probably damaging Het
Kdm5d A G Y: 940,981 Y1122C probably damaging Het
Kif7 A C 7: 79,704,724 L771R probably damaging Het
Krt9 C G 11: 100,188,908 G553R unknown Het
Lama3 G A 18: 12,462,812 A933T probably benign Het
Muc16 A G 9: 18,551,688 I7406T unknown Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntng2 G T 2: 29,194,986 C535* probably null Het
Olfr1375 A T 11: 51,048,334 T76S possibly damaging Het
Olfr594 A T 7: 103,220,655 *312C probably null Het
Omg A G 11: 79,502,225 M269T probably benign Het
Parp2 T C 14: 50,819,393 S325P probably benign Het
Pclo C T 5: 14,678,514 T2462M unknown Het
Pi4ka G T 16: 17,282,301 H1912N Het
Piezo2 T C 18: 63,157,231 I152M probably benign Het
Pigv A T 4: 133,665,679 L60Q probably damaging Het
Plcz1 T A 6: 140,007,755 K379* probably null Het
Poll T C 19: 45,553,652 N405S probably benign Het
Pou6f2 T A 13: 18,129,030 I467F Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Psg26 T C 7: 18,478,457 I324M probably damaging Het
Ptprh T A 7: 4,571,971 I350F probably damaging Het
Slpi C T 2: 164,354,897 V126I probably benign Het
Smarca5 C T 8: 80,704,629 W986* probably null Het
Sorcs1 A G 19: 50,262,295 I366T probably damaging Het
Sv2c G T 13: 96,088,237 S188* probably null Het
Sycp2 T C 2: 178,355,113 K1099R probably damaging Het
Tdp2 C A 13: 24,836,933 Y178* probably null Het
Trabd2b A G 4: 114,602,925 E420G probably damaging Het
Uggt2 A T 14: 119,057,563 H550Q probably benign Het
Vmn2r66 T C 7: 85,005,742 K453R probably benign Het
Vsig10l A G 7: 43,463,233 M1V probably null Het
Wdr70 G A 15: 7,873,203 S646L probably benign Het
Zfp219 A T 14: 52,008,948 S241T probably damaging Het
Zfp24 G A 18: 24,014,269 H329Y probably damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128664032 missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128641402 missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128634708 missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128622506 missense possibly damaging 0.82
R9314:Anapc1 UTSW 2 128622500 missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128617722 missense probably benign 0.08
R9415:Anapc1 UTSW 2 128634678 missense probably benign
R9436:Anapc1 UTSW 2 128676125 missense probably benign
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTACCCATTACTATCTGAGTCAG -3'
(R):5'- GGTTCACAAGCAATTGGATCTCG -3'

Sequencing Primer
(F):5'- CCCATTACTATCTGAGTCAGTTTTAG -3'
(R):5'- CACAAGCAATTGGATCTCGTTAAC -3'
Posted On 2022-02-07