Mutagenetix > Incidental Mutation

Incidental Mutation 'R9203:Cc2d2a'

698311

Institutional Source

Beutler Lab

Gene Symbol

Cc2d2a

Ensembl Gene

ENSMUSG00000039765

Gene Name

coiled-coil and C2 domain containing 2A

Synonyms

b2b1035Clo, 5730509K17Rik

MMRRC Submission

Accession Numbers

Genbank: NM_172274; MGI: 1924487

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R9203 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43662346-43740972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43733837 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 1372 (D1372Y)

Ref Sequence

ENSEMBL: ENSMUSP00000048320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]

AlphaFold

Q8CFW7

Predicted Effect

probably benign
Transcript: ENSMUST00000048150
AA Change: D1372Y

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: D1372Y

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125866
AA Change: D1311Y

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: D1311Y

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc1	T	C	2: 128,623,502	H1686R	possibly damaging	Het
Ankrd33b	A	G	15: 31,297,882	M243T	probably benign	Het
Appl1	G	T	14: 26,961,013	S104*	probably null	Het
Appl2	A	T	10: 83,641,015	Y48*	probably null	Het
Cacna1d	T	C	14: 30,051,712	N1694S	probably benign	Het
Cdh4	C	T	2: 179,780,403	R107C	probably damaging	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cfap54	T	G	10: 93,045,128	M358L	probably benign	Het
Csnka2ip	T	A	16: 64,478,267	D578V	unknown	Het
Ctns	T	C	11: 73,191,737	I56V	probably benign	Het
Dnah9	A	G	11: 65,855,287	I4000T	possibly damaging	Het
Dock2	A	G	11: 34,731,539	V91A	possibly damaging	Het
Dpep2	T	C	8: 105,986,253	H335R	probably damaging	Het
Eno1	C	T	4: 150,248,082	R400*	probably null	Het
Fam114a1	C	A	5: 64,979,957	P81H	probably damaging	Het
Gemin6	A	G	17: 80,227,808	T66A	probably benign	Het
Grm4	T	C	17: 27,435,006	I657V	probably benign	Het
Has3	T	C	8: 106,874,220	C105R	probably damaging	Het
Hecw1	T	C	13: 14,316,658	E170G	probably benign	Het
Hist1h2an	T	C	13: 21,786,887	N111S	probably benign	Het
Hoxd3	T	C	2: 74,746,400	V208A	probably damaging	Het
Hypk	C	T	2: 121,457,682	Q75*	probably null	Het
Itpkb	T	A	1: 180,333,439	W377R	probably benign	Het
Kbtbd2	A	T	6: 56,779,002	V583E	probably damaging	Het
Kdm5d	A	G	Y: 940,981	Y1122C	probably damaging	Het
Kif7	A	C	7: 79,704,724	L771R	probably damaging	Het
Krt9	C	G	11: 100,188,908	G553R	unknown	Het
Lama3	G	A	18: 12,462,812	A933T	probably benign	Het
Muc16	A	G	9: 18,551,688	I7406T	unknown	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Ntng2	G	T	2: 29,194,986	C535*	probably null	Het
Olfr1375	A	T	11: 51,048,334	T76S	possibly damaging	Het
Olfr594	A	T	7: 103,220,655	*312C	probably null	Het
Omg	A	G	11: 79,502,225	M269T	probably benign	Het
Parp2	T	C	14: 50,819,393	S325P	probably benign	Het
Pclo	C	T	5: 14,678,514	T2462M	unknown	Het
Pi4ka	G	T	16: 17,282,301	H1912N		Het
Piezo2	T	C	18: 63,157,231	I152M	probably benign	Het
Pigv	A	T	4: 133,665,679	L60Q	probably damaging	Het
Plcz1	T	A	6: 140,007,755	K379*	probably null	Het
Poll	T	C	19: 45,553,652	N405S	probably benign	Het
Pou6f2	T	A	13: 18,129,030	I467F		Het
Pramef6	T	A	4: 143,897,076	N176I	probably benign	Het
Psg26	T	C	7: 18,478,457	I324M	probably damaging	Het
Ptprh	T	A	7: 4,571,971	I350F	probably damaging	Het
Slpi	C	T	2: 164,354,897	V126I	probably benign	Het
Smarca5	C	T	8: 80,704,629	W986*	probably null	Het
Sorcs1	A	G	19: 50,262,295	I366T	probably damaging	Het
Sv2c	G	T	13: 96,088,237	S188*	probably null	Het
Sycp2	T	C	2: 178,355,113	K1099R	probably damaging	Het
Tdp2	C	A	13: 24,836,933	Y178*	probably null	Het
Trabd2b	A	G	4: 114,602,925	E420G	probably damaging	Het
Uggt2	A	T	14: 119,057,563	H550Q	probably benign	Het
Vmn2r66	T	C	7: 85,005,742	K453R	probably benign	Het
Vsig10l	A	G	7: 43,463,233	M1V	probably null	Het
Wdr70	G	A	15: 7,873,203	S646L	probably benign	Het
Zfp219	A	T	14: 52,008,948	S241T	probably damaging	Het
Zfp24	G	A	18: 24,014,269	H329Y	probably damaging	Het

Other mutations in Cc2d2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cc2d2a	APN	5	43724380	splice site	probably benign
IGL00937:Cc2d2a	APN	5	43688122	critical splice acceptor site	probably null
IGL01322:Cc2d2a	APN	5	43689003	missense	probably benign	0.00
IGL01349:Cc2d2a	APN	5	43723784	missense	probably benign	0.01
IGL01448:Cc2d2a	APN	5	43684185	missense	possibly damaging	0.65
IGL01871:Cc2d2a	APN	5	43688969	missense	probably damaging	0.98
IGL01947:Cc2d2a	APN	5	43688237	missense	probably damaging	0.96
IGL01976:Cc2d2a	APN	5	43683115	missense	probably benign	0.02
IGL02113:Cc2d2a	APN	5	43685248	splice site	probably null
IGL02364:Cc2d2a	APN	5	43735450	missense	probably damaging	1.00
IGL02448:Cc2d2a	APN	5	43683205	splice site	probably benign
IGL02458:Cc2d2a	APN	5	43718554	missense	probably benign	0.01
IGL02542:Cc2d2a	APN	5	43688910	splice site	probably benign
IGL02834:Cc2d2a	APN	5	43714521	nonsense	probably null
IGL02940:Cc2d2a	APN	5	43728294	splice site	probably null
IGL03003:Cc2d2a	APN	5	43671266	missense	probably benign	0.22
IGL03183:Cc2d2a	APN	5	43732379	missense	probably damaging	1.00
C9142:Cc2d2a	UTSW	5	43735457	splice site	probably benign
P0028:Cc2d2a	UTSW	5	43684199	missense	probably benign
R0193:Cc2d2a	UTSW	5	43736118	missense	probably damaging	1.00
R0201:Cc2d2a	UTSW	5	43737512	missense	probably damaging	1.00
R0211:Cc2d2a	UTSW	5	43688266	splice site	probably null
R0243:Cc2d2a	UTSW	5	43696638	splice site	probably benign
R0317:Cc2d2a	UTSW	5	43706901	critical splice donor site	probably null
R0453:Cc2d2a	UTSW	5	43703294	missense	probably benign	0.00
R0558:Cc2d2a	UTSW	5	43724387	splice site	probably benign
R0624:Cc2d2a	UTSW	5	43730029	missense	probably benign
R0634:Cc2d2a	UTSW	5	43681381	splice site	probably benign
R1503:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R1635:Cc2d2a	UTSW	5	43722470	missense	probably damaging	1.00
R1686:Cc2d2a	UTSW	5	43739371	missense	possibly damaging	0.81
R1707:Cc2d2a	UTSW	5	43723688	splice site	probably null
R1715:Cc2d2a	UTSW	5	43718661	missense	probably damaging	0.97
R1765:Cc2d2a	UTSW	5	43714531	missense	probably damaging	0.99
R1794:Cc2d2a	UTSW	5	43688252	missense	probably damaging	1.00
R1881:Cc2d2a	UTSW	5	43740828	missense	probably damaging	0.99
R1917:Cc2d2a	UTSW	5	43706222	missense	probably damaging	1.00
R2005:Cc2d2a	UTSW	5	43726373	critical splice donor site	probably null
R2201:Cc2d2a	UTSW	5	43684033	splice site	probably benign
R2244:Cc2d2a	UTSW	5	43732433	missense	probably damaging	1.00
R2368:Cc2d2a	UTSW	5	43703888	missense	probably benign
R2442:Cc2d2a	UTSW	5	43671305	critical splice donor site	probably null
R2511:Cc2d2a	UTSW	5	43735395	missense	probably damaging	0.99
R3023:Cc2d2a	UTSW	5	43685251	splice site	probably null
R3147:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3148:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3426:Cc2d2a	UTSW	5	43736109	missense	probably benign	0.00
R3609:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3610:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3611:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3839:Cc2d2a	UTSW	5	43718714	missense	probably benign
R3870:Cc2d2a	UTSW	5	43718691	nonsense	probably null
R4334:Cc2d2a	UTSW	5	43683134	missense	probably benign	0.00
R4913:Cc2d2a	UTSW	5	43739323	missense	probably benign	0.12
R5179:Cc2d2a	UTSW	5	43688221	missense	possibly damaging	0.82
R5315:Cc2d2a	UTSW	5	43720433	missense	probably damaging	0.99
R5352:Cc2d2a	UTSW	5	43706213	missense	probably damaging	1.00
R5386:Cc2d2a	UTSW	5	43730041	missense	probably benign	0.01
R5538:Cc2d2a	UTSW	5	43695176	missense	possibly damaging	0.94
R5568:Cc2d2a	UTSW	5	43709091	missense	probably damaging	0.99
R5618:Cc2d2a	UTSW	5	43729907	missense	probably benign	0.00
R5653:Cc2d2a	UTSW	5	43722462	missense	possibly damaging	0.81
R5817:Cc2d2a	UTSW	5	43712418	missense	probably damaging	1.00
R5858:Cc2d2a	UTSW	5	43715775	missense	probably damaging	1.00
R5905:Cc2d2a	UTSW	5	43712426	missense	probably benign
R5912:Cc2d2a	UTSW	5	43720430	missense	probably damaging	0.97
R6073:Cc2d2a	UTSW	5	43729975	missense	probably damaging	1.00
R6084:Cc2d2a	UTSW	5	43668673	missense	probably benign
R6142:Cc2d2a	UTSW	5	43703198	missense	probably damaging	0.97
R6176:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.32
R6238:Cc2d2a	UTSW	5	43671235	missense	probably benign	0.11
R6381:Cc2d2a	UTSW	5	43715776	missense	possibly damaging	0.69
R6404:Cc2d2a	UTSW	5	43704074	missense	possibly damaging	0.58
R6455:Cc2d2a	UTSW	5	43739412	missense	possibly damaging	0.69
R6695:Cc2d2a	UTSW	5	43718677	missense	probably damaging	0.99
R6805:Cc2d2a	UTSW	5	43681331	missense	probably damaging	1.00
R6919:Cc2d2a	UTSW	5	43703215	missense	probably benign	0.19
R6970:Cc2d2a	UTSW	5	43718585	missense	probably damaging	1.00
R7024:Cc2d2a	UTSW	5	43733929	missense	probably benign	0.10
R7054:Cc2d2a	UTSW	5	43699979	nonsense	probably null
R7071:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.13
R7098:Cc2d2a	UTSW	5	43683139	missense	probably benign	0.00
R7366:Cc2d2a	UTSW	5	43729990	missense	probably damaging	1.00
R7908:Cc2d2a	UTSW	5	43706846	missense	probably benign	0.00
R7920:Cc2d2a	UTSW	5	43739309	missense	probably benign	0.09
R7950:Cc2d2a	UTSW	5	43695296	critical splice donor site	probably null
R8007:Cc2d2a	UTSW	5	43706100	missense	possibly damaging	0.71
R8117:Cc2d2a	UTSW	5	43712439	missense	probably damaging	1.00
R8123:Cc2d2a	UTSW	5	43710554	missense	probably benign
R8179:Cc2d2a	UTSW	5	43699953	missense	probably damaging	0.96
R8279:Cc2d2a	UTSW	5	43736145	missense	probably benign	0.01
R8293:Cc2d2a	UTSW	5	43688228	missense	probably damaging	0.97
R8480:Cc2d2a	UTSW	5	43685144	splice site	probably null
R8482:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R8731:Cc2d2a	UTSW	5	43735446	missense	probably damaging	1.00
R8780:Cc2d2a	UTSW	5	43739350	missense	probably damaging	1.00
R8784:Cc2d2a	UTSW	5	43703303	missense	possibly damaging	0.90
R8871:Cc2d2a	UTSW	5	43699943	missense	possibly damaging	0.71
R8972:Cc2d2a	UTSW	5	43710542	missense	probably benign
R9122:Cc2d2a	UTSW	5	43673739	missense	probably null	0.07
R9125:Cc2d2a	UTSW	5	43703221	missense	probably benign
R9310:Cc2d2a	UTSW	5	43695146	missense	probably damaging	1.00
R9343:Cc2d2a	UTSW	5	43718657	missense	probably damaging	1.00
R9353:Cc2d2a	UTSW	5	43703349	critical splice donor site	probably null
Z1177:Cc2d2a	UTSW	5	43703204	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGGCACTAATCTCAACTCAC -3'
(R):5'- GCAGTTCAGATGTCATGAAAAGC -3'

Sequencing Primer
(F):5'- CCTTTAATCCTAGTACTTGGCGGAAG -3'
(R):5'- TCAGATGTCATGAAAAGCATCTAGG -3'

Posted On

2022-02-07