Incidental Mutation 'R9203:Smarca5'
ID 698321
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9203 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 80704629 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 986 (W986*)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably null
Transcript: ENSMUST00000043359
AA Change: W986*
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: W986*

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,623,502 H1686R possibly damaging Het
Ankrd33b A G 15: 31,297,882 M243T probably benign Het
Appl1 G T 14: 26,961,013 S104* probably null Het
Appl2 A T 10: 83,641,015 Y48* probably null Het
Cacna1d T C 14: 30,051,712 N1694S probably benign Het
Cc2d2a G T 5: 43,733,837 D1372Y probably benign Het
Cdh4 C T 2: 179,780,403 R107C probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cfap54 T G 10: 93,045,128 M358L probably benign Het
Csnka2ip T A 16: 64,478,267 D578V unknown Het
Ctns T C 11: 73,191,737 I56V probably benign Het
Dnah9 A G 11: 65,855,287 I4000T possibly damaging Het
Dock2 A G 11: 34,731,539 V91A possibly damaging Het
Dpep2 T C 8: 105,986,253 H335R probably damaging Het
Eno1 C T 4: 150,248,082 R400* probably null Het
Fam114a1 C A 5: 64,979,957 P81H probably damaging Het
Gemin6 A G 17: 80,227,808 T66A probably benign Het
Grm4 T C 17: 27,435,006 I657V probably benign Het
Has3 T C 8: 106,874,220 C105R probably damaging Het
Hecw1 T C 13: 14,316,658 E170G probably benign Het
Hist1h2an T C 13: 21,786,887 N111S probably benign Het
Hoxd3 T C 2: 74,746,400 V208A probably damaging Het
Hypk C T 2: 121,457,682 Q75* probably null Het
Itpkb T A 1: 180,333,439 W377R probably benign Het
Kbtbd2 A T 6: 56,779,002 V583E probably damaging Het
Kdm5d A G Y: 940,981 Y1122C probably damaging Het
Kif7 A C 7: 79,704,724 L771R probably damaging Het
Krt9 C G 11: 100,188,908 G553R unknown Het
Lama3 G A 18: 12,462,812 A933T probably benign Het
Muc16 A G 9: 18,551,688 I7406T unknown Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntng2 G T 2: 29,194,986 C535* probably null Het
Olfr1375 A T 11: 51,048,334 T76S possibly damaging Het
Olfr594 A T 7: 103,220,655 *312C probably null Het
Omg A G 11: 79,502,225 M269T probably benign Het
Parp2 T C 14: 50,819,393 S325P probably benign Het
Pclo C T 5: 14,678,514 T2462M unknown Het
Pi4ka G T 16: 17,282,301 H1912N Het
Piezo2 T C 18: 63,157,231 I152M probably benign Het
Pigv A T 4: 133,665,679 L60Q probably damaging Het
Plcz1 T A 6: 140,007,755 K379* probably null Het
Poll T C 19: 45,553,652 N405S probably benign Het
Pou6f2 T A 13: 18,129,030 I467F Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Psg26 T C 7: 18,478,457 I324M probably damaging Het
Ptprh T A 7: 4,571,971 I350F probably damaging Het
Slpi C T 2: 164,354,897 V126I probably benign Het
Sorcs1 A G 19: 50,262,295 I366T probably damaging Het
Sv2c G T 13: 96,088,237 S188* probably null Het
Sycp2 T C 2: 178,355,113 K1099R probably damaging Het
Tdp2 C A 13: 24,836,933 Y178* probably null Het
Trabd2b A G 4: 114,602,925 E420G probably damaging Het
Uggt2 A T 14: 119,057,563 H550Q probably benign Het
Vmn2r66 T C 7: 85,005,742 K453R probably benign Het
Vsig10l A G 7: 43,463,233 M1V probably null Het
Wdr70 G A 15: 7,873,203 S646L probably benign Het
Zfp219 A T 14: 52,008,948 S241T probably damaging Het
Zfp24 G A 18: 24,014,269 H329Y probably damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Encryption UTSW 8 80704726 missense probably damaging 1.00
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCTCACTGTATAAAGCCATG -3'
(R):5'- TTGGACGGTACAAAGCACCC -3'

Sequencing Primer
(F):5'- CTCACTGTATAAAGCCATGTTAAAAC -3'
(R):5'- GGTACAAAGCACCCTTTCATCAG -3'
Posted On 2022-02-07