Incidental Mutation 'R9203:Appl2'
ID 698325
Institutional Source Beutler Lab
Gene Symbol Appl2
Ensembl Gene ENSMUSG00000020263
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Synonyms Dip3b
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9203 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 83435897-83484602 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 83476879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 48 (Y48*)
Ref Sequence ENSEMBL: ENSMUSP00000020500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020500] [ENSMUST00000146876] [ENSMUST00000150685] [ENSMUST00000176294]
AlphaFold Q8K3G9
Predicted Effect probably null
Transcript: ENSMUST00000020500
AA Change: Y48*
SMART Domains Protein: ENSMUSP00000020500
Gene: ENSMUSG00000020263
AA Change: Y48*

DomainStartEndE-ValueType
Pfam:BAR_3 7 248 6.4e-69 PFAM
PH 278 377 1.2e-7 SMART
Pfam:PTB 491 613 6e-7 PFAM
Pfam:PID 492 611 1.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146876
AA Change: Y48*
SMART Domains Protein: ENSMUSP00000121336
Gene: ENSMUSG00000020263
AA Change: Y48*

DomainStartEndE-ValueType
PDB:4H8S|D 2 209 1e-141 PDB
Predicted Effect probably null
Transcript: ENSMUST00000150685
AA Change: Y48*
SMART Domains Protein: ENSMUSP00000115903
Gene: ENSMUSG00000020263
AA Change: Y48*

DomainStartEndE-ValueType
PDB:4H8S|D 2 95 4e-59 PDB
Predicted Effect probably null
Transcript: ENSMUST00000176294
AA Change: Y48*
SMART Domains Protein: ENSMUSP00000135645
Gene: ENSMUSG00000020263
AA Change: Y48*

DomainStartEndE-ValueType
PDB:4H8S|D 2 95 1e-53 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele display altered red blood cell physiology. Mutant MEFs exhibit defects in HGF-induced Akt activation, migration, and invasion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,465,422 (GRCm39) H1686R possibly damaging Het
Ankrd33b A G 15: 31,298,028 (GRCm39) M243T probably benign Het
Appl1 G T 14: 26,682,970 (GRCm39) S104* probably null Het
Cacna1d T C 14: 29,773,669 (GRCm39) N1694S probably benign Het
Cc2d2a G T 5: 43,891,179 (GRCm39) D1372Y probably benign Het
Cdh4 C T 2: 179,422,196 (GRCm39) R107C probably damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cfap54 T G 10: 92,880,990 (GRCm39) M358L probably benign Het
Csnka2ip T A 16: 64,298,630 (GRCm39) D578V unknown Het
Ctns T C 11: 73,082,563 (GRCm39) I56V probably benign Het
Dnah9 A G 11: 65,746,113 (GRCm39) I4000T possibly damaging Het
Dock2 A G 11: 34,622,366 (GRCm39) V91A possibly damaging Het
Dpep2 T C 8: 106,712,885 (GRCm39) H335R probably damaging Het
Eno1 C T 4: 150,332,539 (GRCm39) R400* probably null Het
Fam114a1 C A 5: 65,137,300 (GRCm39) P81H probably damaging Het
Gemin6 A G 17: 80,535,237 (GRCm39) T66A probably benign Het
Grm4 T C 17: 27,653,980 (GRCm39) I657V probably benign Het
H2ac22 T C 13: 21,971,057 (GRCm39) N111S probably benign Het
Has3 T C 8: 107,600,852 (GRCm39) C105R probably damaging Het
Hecw1 T C 13: 14,491,243 (GRCm39) E170G probably benign Het
Hoxd3 T C 2: 74,576,744 (GRCm39) V208A probably damaging Het
Hypk C T 2: 121,288,163 (GRCm39) Q75* probably null Het
Itpkb T A 1: 180,161,004 (GRCm39) W377R probably benign Het
Kbtbd2 A T 6: 56,755,987 (GRCm39) V583E probably damaging Het
Kdm5d A G Y: 940,981 (GRCm39) Y1122C probably damaging Het
Kif7 A C 7: 79,354,472 (GRCm39) L771R probably damaging Het
Krt9 C G 11: 100,079,734 (GRCm39) G553R unknown Het
Lama3 G A 18: 12,595,869 (GRCm39) A933T probably benign Het
Muc16 A G 9: 18,462,984 (GRCm39) I7406T unknown Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Ntng2 G T 2: 29,084,998 (GRCm39) C535* probably null Het
Omg A G 11: 79,393,051 (GRCm39) M269T probably benign Het
Or1x6 A T 11: 50,939,161 (GRCm39) T76S possibly damaging Het
Or52e3 A T 7: 102,869,862 (GRCm39) *312C probably null Het
Parp2 T C 14: 51,056,850 (GRCm39) S325P probably benign Het
Pclo C T 5: 14,728,528 (GRCm39) T2462M unknown Het
Pi4ka G T 16: 17,100,165 (GRCm39) H1912N Het
Piezo2 T C 18: 63,290,302 (GRCm39) I152M probably benign Het
Pigv A T 4: 133,392,990 (GRCm39) L60Q probably damaging Het
Plcz1 T A 6: 139,953,481 (GRCm39) K379* probably null Het
Poll T C 19: 45,542,091 (GRCm39) N405S probably benign Het
Pou6f2 T A 13: 18,303,615 (GRCm39) I467F Het
Pramel11 T A 4: 143,623,646 (GRCm39) N176I probably benign Het
Psg26 T C 7: 18,212,382 (GRCm39) I324M probably damaging Het
Ptprh T A 7: 4,574,970 (GRCm39) I350F probably damaging Het
Slpi C T 2: 164,196,817 (GRCm39) V126I probably benign Het
Smarca5 C T 8: 81,431,258 (GRCm39) W986* probably null Het
Sorcs1 A G 19: 50,250,733 (GRCm39) I366T probably damaging Het
Sv2c G T 13: 96,224,745 (GRCm39) S188* probably null Het
Sycp2 T C 2: 177,996,906 (GRCm39) K1099R probably damaging Het
Tdp2 C A 13: 25,020,916 (GRCm39) Y178* probably null Het
Trabd2b A G 4: 114,460,122 (GRCm39) E420G probably damaging Het
Uggt2 A T 14: 119,294,975 (GRCm39) H550Q probably benign Het
Vmn2r66 T C 7: 84,654,950 (GRCm39) K453R probably benign Het
Vsig10l A G 7: 43,112,657 (GRCm39) M1V probably null Het
Wdr70 G A 15: 7,902,684 (GRCm39) S646L probably benign Het
Zfp219 A T 14: 52,246,405 (GRCm39) S241T probably damaging Het
Zfp24 G A 18: 24,147,326 (GRCm39) H329Y probably damaging Het
Other mutations in Appl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Appl2 APN 10 83,450,165 (GRCm39) missense possibly damaging 0.95
IGL01794:Appl2 APN 10 83,450,158 (GRCm39) missense probably benign
IGL01887:Appl2 APN 10 83,457,386 (GRCm39) unclassified probably benign
IGL03071:Appl2 APN 10 83,476,970 (GRCm39) critical splice acceptor site probably null
IGL03077:Appl2 APN 10 83,457,623 (GRCm39) unclassified probably benign
R0006:Appl2 UTSW 10 83,438,762 (GRCm39) missense probably damaging 1.00
R0006:Appl2 UTSW 10 83,438,762 (GRCm39) missense probably damaging 1.00
R0591:Appl2 UTSW 10 83,460,509 (GRCm39) missense possibly damaging 0.94
R1695:Appl2 UTSW 10 83,457,446 (GRCm39) missense probably damaging 0.99
R2217:Appl2 UTSW 10 83,444,601 (GRCm39) missense possibly damaging 0.47
R2218:Appl2 UTSW 10 83,444,601 (GRCm39) missense possibly damaging 0.47
R4782:Appl2 UTSW 10 83,436,855 (GRCm39) missense probably damaging 1.00
R4889:Appl2 UTSW 10 83,476,922 (GRCm39) missense probably damaging 1.00
R5109:Appl2 UTSW 10 83,436,871 (GRCm39) missense probably benign 0.06
R5460:Appl2 UTSW 10 83,438,696 (GRCm39) missense probably benign 0.00
R5512:Appl2 UTSW 10 83,441,682 (GRCm39) missense probably damaging 1.00
R6023:Appl2 UTSW 10 83,484,393 (GRCm39) missense probably null 0.00
R6047:Appl2 UTSW 10 83,448,765 (GRCm39) critical splice acceptor site probably null
R7403:Appl2 UTSW 10 83,450,059 (GRCm39) missense probably benign 0.00
R7537:Appl2 UTSW 10 83,453,292 (GRCm39) missense possibly damaging 0.69
R8488:Appl2 UTSW 10 83,446,866 (GRCm39) missense probably benign 0.02
X0027:Appl2 UTSW 10 83,457,418 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATAGGGGCCCACATACAC -3'
(R):5'- TGAGCTCCAGACACTTTCCC -3'

Sequencing Primer
(F):5'- TGACTGGCCAATACGCTCTAG -3'
(R):5'- AGACACTTTCCCTCCCAGG -3'
Posted On 2022-02-07