Incidental Mutation 'R9203:Sv2c'
ID 698337
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9203 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 96224745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 188 (S188*)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably null
Transcript: ENSMUST00000161263
AA Change: S188*
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: S188*

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182289
AA Change: S188*
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: S188*

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,465,422 (GRCm39) H1686R possibly damaging Het
Ankrd33b A G 15: 31,298,028 (GRCm39) M243T probably benign Het
Appl1 G T 14: 26,682,970 (GRCm39) S104* probably null Het
Appl2 A T 10: 83,476,879 (GRCm39) Y48* probably null Het
Cacna1d T C 14: 29,773,669 (GRCm39) N1694S probably benign Het
Cc2d2a G T 5: 43,891,179 (GRCm39) D1372Y probably benign Het
Cdh4 C T 2: 179,422,196 (GRCm39) R107C probably damaging Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cfap54 T G 10: 92,880,990 (GRCm39) M358L probably benign Het
Csnka2ip T A 16: 64,298,630 (GRCm39) D578V unknown Het
Ctns T C 11: 73,082,563 (GRCm39) I56V probably benign Het
Dnah9 A G 11: 65,746,113 (GRCm39) I4000T possibly damaging Het
Dock2 A G 11: 34,622,366 (GRCm39) V91A possibly damaging Het
Dpep2 T C 8: 106,712,885 (GRCm39) H335R probably damaging Het
Eno1 C T 4: 150,332,539 (GRCm39) R400* probably null Het
Fam114a1 C A 5: 65,137,300 (GRCm39) P81H probably damaging Het
Gemin6 A G 17: 80,535,237 (GRCm39) T66A probably benign Het
Grm4 T C 17: 27,653,980 (GRCm39) I657V probably benign Het
H2ac22 T C 13: 21,971,057 (GRCm39) N111S probably benign Het
Has3 T C 8: 107,600,852 (GRCm39) C105R probably damaging Het
Hecw1 T C 13: 14,491,243 (GRCm39) E170G probably benign Het
Hoxd3 T C 2: 74,576,744 (GRCm39) V208A probably damaging Het
Hypk C T 2: 121,288,163 (GRCm39) Q75* probably null Het
Itpkb T A 1: 180,161,004 (GRCm39) W377R probably benign Het
Kbtbd2 A T 6: 56,755,987 (GRCm39) V583E probably damaging Het
Kdm5d A G Y: 940,981 (GRCm39) Y1122C probably damaging Het
Kif7 A C 7: 79,354,472 (GRCm39) L771R probably damaging Het
Krt9 C G 11: 100,079,734 (GRCm39) G553R unknown Het
Lama3 G A 18: 12,595,869 (GRCm39) A933T probably benign Het
Muc16 A G 9: 18,462,984 (GRCm39) I7406T unknown Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Ntng2 G T 2: 29,084,998 (GRCm39) C535* probably null Het
Omg A G 11: 79,393,051 (GRCm39) M269T probably benign Het
Or1x6 A T 11: 50,939,161 (GRCm39) T76S possibly damaging Het
Or52e3 A T 7: 102,869,862 (GRCm39) *312C probably null Het
Parp2 T C 14: 51,056,850 (GRCm39) S325P probably benign Het
Pclo C T 5: 14,728,528 (GRCm39) T2462M unknown Het
Pi4ka G T 16: 17,100,165 (GRCm39) H1912N Het
Piezo2 T C 18: 63,290,302 (GRCm39) I152M probably benign Het
Pigv A T 4: 133,392,990 (GRCm39) L60Q probably damaging Het
Plcz1 T A 6: 139,953,481 (GRCm39) K379* probably null Het
Poll T C 19: 45,542,091 (GRCm39) N405S probably benign Het
Pou6f2 T A 13: 18,303,615 (GRCm39) I467F Het
Pramel11 T A 4: 143,623,646 (GRCm39) N176I probably benign Het
Psg26 T C 7: 18,212,382 (GRCm39) I324M probably damaging Het
Ptprh T A 7: 4,574,970 (GRCm39) I350F probably damaging Het
Slpi C T 2: 164,196,817 (GRCm39) V126I probably benign Het
Smarca5 C T 8: 81,431,258 (GRCm39) W986* probably null Het
Sorcs1 A G 19: 50,250,733 (GRCm39) I366T probably damaging Het
Sycp2 T C 2: 177,996,906 (GRCm39) K1099R probably damaging Het
Tdp2 C A 13: 25,020,916 (GRCm39) Y178* probably null Het
Trabd2b A G 4: 114,460,122 (GRCm39) E420G probably damaging Het
Uggt2 A T 14: 119,294,975 (GRCm39) H550Q probably benign Het
Vmn2r66 T C 7: 84,654,950 (GRCm39) K453R probably benign Het
Vsig10l A G 7: 43,112,657 (GRCm39) M1V probably null Het
Wdr70 G A 15: 7,902,684 (GRCm39) S646L probably benign Het
Zfp219 A T 14: 52,246,405 (GRCm39) S241T probably damaging Het
Zfp24 G A 18: 24,147,326 (GRCm39) H329Y probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTAATGATGGCTACATAAAACC -3'
(R):5'- GTGATGAGTACAAGGACCGC -3'

Sequencing Primer
(F):5'- ATGCCATGCTCTAAATCAGTGGC -3'
(R):5'- ACCGCAGAGAGCTAGAGTC -3'
Posted On 2022-02-07