Incidental Mutation 'R9203:Csnka2ip'
ID 698347
Institutional Source Beutler Lab
Gene Symbol Csnka2ip
Ensembl Gene ENSMUSG00000068167
Gene Name casein kinase 2, alpha prime interacting protein
Synonyms Ckt2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R9203 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 64477810-64602408 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64478267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 578 (D578V)
Ref Sequence ENSEMBL: ENSMUSP00000147880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089279] [ENSMUST00000209382]
AlphaFold Q8CH19
Predicted Effect unknown
Transcript: ENSMUST00000089279
AA Change: D134V
SMART Domains Protein: ENSMUSP00000086692
Gene: ENSMUSG00000068167
AA Change: D134V

DomainStartEndE-ValueType
low complexity region 164 182 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209382
AA Change: D578V
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,623,502 H1686R possibly damaging Het
Ankrd33b A G 15: 31,297,882 M243T probably benign Het
Appl1 G T 14: 26,961,013 S104* probably null Het
Appl2 A T 10: 83,641,015 Y48* probably null Het
Cacna1d T C 14: 30,051,712 N1694S probably benign Het
Cc2d2a G T 5: 43,733,837 D1372Y probably benign Het
Cdh4 C T 2: 179,780,403 R107C probably damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cfap54 T G 10: 93,045,128 M358L probably benign Het
Ctns T C 11: 73,191,737 I56V probably benign Het
Dnah9 A G 11: 65,855,287 I4000T possibly damaging Het
Dock2 A G 11: 34,731,539 V91A possibly damaging Het
Dpep2 T C 8: 105,986,253 H335R probably damaging Het
Eno1 C T 4: 150,248,082 R400* probably null Het
Fam114a1 C A 5: 64,979,957 P81H probably damaging Het
Gemin6 A G 17: 80,227,808 T66A probably benign Het
Grm4 T C 17: 27,435,006 I657V probably benign Het
Has3 T C 8: 106,874,220 C105R probably damaging Het
Hecw1 T C 13: 14,316,658 E170G probably benign Het
Hist1h2an T C 13: 21,786,887 N111S probably benign Het
Hoxd3 T C 2: 74,746,400 V208A probably damaging Het
Hypk C T 2: 121,457,682 Q75* probably null Het
Itpkb T A 1: 180,333,439 W377R probably benign Het
Kbtbd2 A T 6: 56,779,002 V583E probably damaging Het
Kdm5d A G Y: 940,981 Y1122C probably damaging Het
Kif7 A C 7: 79,704,724 L771R probably damaging Het
Krt9 C G 11: 100,188,908 G553R unknown Het
Lama3 G A 18: 12,462,812 A933T probably benign Het
Muc16 A G 9: 18,551,688 I7406T unknown Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntng2 G T 2: 29,194,986 C535* probably null Het
Olfr1375 A T 11: 51,048,334 T76S possibly damaging Het
Olfr594 A T 7: 103,220,655 *312C probably null Het
Omg A G 11: 79,502,225 M269T probably benign Het
Parp2 T C 14: 50,819,393 S325P probably benign Het
Pclo C T 5: 14,678,514 T2462M unknown Het
Pi4ka G T 16: 17,282,301 H1912N Het
Piezo2 T C 18: 63,157,231 I152M probably benign Het
Pigv A T 4: 133,665,679 L60Q probably damaging Het
Plcz1 T A 6: 140,007,755 K379* probably null Het
Poll T C 19: 45,553,652 N405S probably benign Het
Pou6f2 T A 13: 18,129,030 I467F Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Psg26 T C 7: 18,478,457 I324M probably damaging Het
Ptprh T A 7: 4,571,971 I350F probably damaging Het
Slpi C T 2: 164,354,897 V126I probably benign Het
Smarca5 C T 8: 80,704,629 W986* probably null Het
Sorcs1 A G 19: 50,262,295 I366T probably damaging Het
Sv2c G T 13: 96,088,237 S188* probably null Het
Sycp2 T C 2: 178,355,113 K1099R probably damaging Het
Tdp2 C A 13: 24,836,933 Y178* probably null Het
Trabd2b A G 4: 114,602,925 E420G probably damaging Het
Uggt2 A T 14: 119,057,563 H550Q probably benign Het
Vmn2r66 T C 7: 85,005,742 K453R probably benign Het
Vsig10l A G 7: 43,463,233 M1V probably null Het
Wdr70 G A 15: 7,873,203 S646L probably benign Het
Zfp219 A T 14: 52,008,948 S241T probably damaging Het
Zfp24 G A 18: 24,014,269 H329Y probably damaging Het
Other mutations in Csnka2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Csnka2ip APN 16 64478594 missense probably damaging 0.99
IGL02677:Csnka2ip APN 16 64478312 missense probably damaging 0.99
G1Funyon:Csnka2ip UTSW 16 64478991 missense unknown
R0593:Csnka2ip UTSW 16 64478612 missense probably damaging 0.99
R1075:Csnka2ip UTSW 16 64477947 nonsense probably null
R1698:Csnka2ip UTSW 16 64478059 nonsense probably null
R1815:Csnka2ip UTSW 16 64478492 missense probably benign
R6446:Csnka2ip UTSW 16 64479381 nonsense probably null
R6709:Csnka2ip UTSW 16 64478569 missense possibly damaging 0.92
R6937:Csnka2ip UTSW 16 64478695 utr 5 prime probably benign
R6999:Csnka2ip UTSW 16 64478570 missense unknown
R7013:Csnka2ip UTSW 16 64478417 missense unknown
R7103:Csnka2ip UTSW 16 64478757 missense unknown
R7395:Csnka2ip UTSW 16 64479440 missense
R7816:Csnka2ip UTSW 16 64479489 unclassified probably benign
R8301:Csnka2ip UTSW 16 64478991 missense unknown
R8416:Csnka2ip UTSW 16 64479932 missense
R8946:Csnka2ip UTSW 16 64480304 splice site probably benign
R9479:Csnka2ip UTSW 16 64477899 missense unknown
Predicted Primers PCR Primer
(F):5'- ATATCCTGAAACCGGAACCG -3'
(R):5'- AGAGAAGCCTTCCTCAACCTG -3'

Sequencing Primer
(F):5'- AACCGGAGTGGGATCTACC -3'
(R):5'- ACCTGTTTCCAACTTCCTATGAAAG -3'
Posted On 2022-02-07