Mutagenetix > Incidental Mutation

Incidental Mutation 'R9203:Piezo2'

698352

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9203 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63157231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 152 (I152M)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046860
AA Change: I152M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: I152M

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047480
AA Change: I152M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: I152M

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183217
AA Change: I152M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: I152M

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc1	T	C	2: 128,623,502 (GRCm38)	H1686R	possibly damaging	Het
Ankrd33b	A	G	15: 31,297,882 (GRCm38)	M243T	probably benign	Het
Appl1	G	T	14: 26,961,013 (GRCm38)	S104*	probably null	Het
Appl2	A	T	10: 83,641,015 (GRCm38)	Y48*	probably null	Het
Cacna1d	T	C	14: 30,051,712 (GRCm38)	N1694S	probably benign	Het
Cc2d2a	G	T	5: 43,733,837 (GRCm38)	D1372Y	probably benign	Het
Cdh4	C	T	2: 179,780,403 (GRCm38)	R107C	probably damaging	Het
Celsr1	G	T	15: 86,033,085 (GRCm38)	S229*	probably null	Het
Cfap54	T	G	10: 93,045,128 (GRCm38)	M358L	probably benign	Het
Csnka2ip	T	A	16: 64,478,267 (GRCm38)	D578V	unknown	Het
Ctns	T	C	11: 73,191,737 (GRCm38)	I56V	probably benign	Het
Dnah9	A	G	11: 65,855,287 (GRCm38)	I4000T	possibly damaging	Het
Dock2	A	G	11: 34,731,539 (GRCm38)	V91A	possibly damaging	Het
Dpep2	T	C	8: 105,986,253 (GRCm38)	H335R	probably damaging	Het
Eno1	C	T	4: 150,248,082 (GRCm38)	R400*	probably null	Het
Fam114a1	C	A	5: 64,979,957 (GRCm38)	P81H	probably damaging	Het
Gemin6	A	G	17: 80,227,808 (GRCm38)	T66A	probably benign	Het
Grm4	T	C	17: 27,435,006 (GRCm38)	I657V	probably benign	Het
Has3	T	C	8: 106,874,220 (GRCm38)	C105R	probably damaging	Het
Hecw1	T	C	13: 14,316,658 (GRCm38)	E170G	probably benign	Het
Hist1h2an	T	C	13: 21,786,887 (GRCm38)	N111S	probably benign	Het
Hoxd3	T	C	2: 74,746,400 (GRCm38)	V208A	probably damaging	Het
Hypk	C	T	2: 121,457,682 (GRCm38)	Q75*	probably null	Het
Itpkb	T	A	1: 180,333,439 (GRCm38)	W377R	probably benign	Het
Kbtbd2	A	T	6: 56,779,002 (GRCm38)	V583E	probably damaging	Het
Kdm5d	A	G	Y: 940,981 (GRCm38)	Y1122C	probably damaging	Het
Kif7	A	C	7: 79,704,724 (GRCm38)	L771R	probably damaging	Het
Krt9	C	G	11: 100,188,908 (GRCm38)	G553R	unknown	Het
Lama3	G	A	18: 12,462,812 (GRCm38)	A933T	probably benign	Het
Muc16	A	G	9: 18,551,688 (GRCm38)	I7406T	unknown	Het
Ndst4	C	T	3: 125,724,736 (GRCm38)	S354L	probably benign	Het
Ntng2	G	T	2: 29,194,986 (GRCm38)	C535*	probably null	Het
Olfr1375	A	T	11: 51,048,334 (GRCm38)	T76S	possibly damaging	Het
Olfr594	A	T	7: 103,220,655 (GRCm38)	*312C	probably null	Het
Omg	A	G	11: 79,502,225 (GRCm38)	M269T	probably benign	Het
Parp2	T	C	14: 50,819,393 (GRCm38)	S325P	probably benign	Het
Pclo	C	T	5: 14,678,514 (GRCm38)	T2462M	unknown	Het
Pi4ka	G	T	16: 17,282,301 (GRCm38)	H1912N		Het
Pigv	A	T	4: 133,665,679 (GRCm38)	L60Q	probably damaging	Het
Plcz1	T	A	6: 140,007,755 (GRCm38)	K379*	probably null	Het
Poll	T	C	19: 45,553,652 (GRCm38)	N405S	probably benign	Het
Pou6f2	T	A	13: 18,129,030 (GRCm38)	I467F		Het
Pramef6	T	A	4: 143,897,076 (GRCm38)	N176I	probably benign	Het
Psg26	T	C	7: 18,478,457 (GRCm38)	I324M	probably damaging	Het
Ptprh	T	A	7: 4,571,971 (GRCm38)	I350F	probably damaging	Het
Slpi	C	T	2: 164,354,897 (GRCm38)	V126I	probably benign	Het
Smarca5	C	T	8: 80,704,629 (GRCm38)	W986*	probably null	Het
Sorcs1	A	G	19: 50,262,295 (GRCm38)	I366T	probably damaging	Het
Sv2c	G	T	13: 96,088,237 (GRCm38)	S188*	probably null	Het
Sycp2	T	C	2: 178,355,113 (GRCm38)	K1099R	probably damaging	Het
Tdp2	C	A	13: 24,836,933 (GRCm38)	Y178*	probably null	Het
Trabd2b	A	G	4: 114,602,925 (GRCm38)	E420G	probably damaging	Het
Uggt2	A	T	14: 119,057,563 (GRCm38)	H550Q	probably benign	Het
Vmn2r66	T	C	7: 85,005,742 (GRCm38)	K453R	probably benign	Het
Vsig10l	A	G	7: 43,463,233 (GRCm38)	M1V	probably null	Het
Wdr70	G	A	15: 7,873,203 (GRCm38)	S646L	probably benign	Het
Zfp219	A	T	14: 52,008,948 (GRCm38)	S241T	probably damaging	Het
Zfp24	G	A	18: 24,014,269 (GRCm38)	H329Y	probably damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,117,699 (GRCm38)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,022,460 (GRCm38)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,070,030 (GRCm38)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,124,614 (GRCm38)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,030,392 (GRCm38)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,182,833 (GRCm38)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,027,559 (GRCm38)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,083,170 (GRCm38)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,042,788 (GRCm38)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,092,844 (GRCm38)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,020,634 (GRCm38)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,146,844 (GRCm38)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,072,862 (GRCm38)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,032,924 (GRCm38)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,024,475 (GRCm38)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,074,659 (GRCm38)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,064,785 (GRCm38)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,124,660 (GRCm38)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,070,075 (GRCm38)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,030,272 (GRCm38)	splice site	probably null
IGL03129:Piezo2	APN	18	63,114,972 (GRCm38)	missense	probably benign
IGL03143:Piezo2	APN	18	63,108,076 (GRCm38)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,011,598 (GRCm38)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,124,606 (GRCm38)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,053,062 (GRCm38)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,041,720 (GRCm38)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,011,538 (GRCm38)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,021,308 (GRCm38)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,027,704 (GRCm38)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
sopranino	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
woodwind	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,386,200 (GRCm38)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,024,469 (GRCm38)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,102,084 (GRCm38)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,024,491 (GRCm38)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,029,061 (GRCm38)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,102,174 (GRCm38)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,024,451 (GRCm38)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,027,544 (GRCm38)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,022,481 (GRCm38)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,022,426 (GRCm38)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,019,258 (GRCm38)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,041,723 (GRCm38)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,083,235 (GRCm38)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,015,802 (GRCm38)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,086,753 (GRCm38)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,021,254 (GRCm38)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,083,131 (GRCm38)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,144,919 (GRCm38)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,082,915 (GRCm38)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,117,672 (GRCm38)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,021,173 (GRCm38)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,106,284 (GRCm38)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,108,087 (GRCm38)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,032,840 (GRCm38)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,019,344 (GRCm38)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,113,960 (GRCm38)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,078,840 (GRCm38)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,078,781 (GRCm38)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,144,926 (GRCm38)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,059,744 (GRCm38)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,118,935 (GRCm38)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,081,734 (GRCm38)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,117,720 (GRCm38)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,114,041 (GRCm38)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,106,274 (GRCm38)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,022,525 (GRCm38)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,245,624 (GRCm38)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,053,035 (GRCm38)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,146,843 (GRCm38)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,024,435 (GRCm38)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,042,832 (GRCm38)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,081,793 (GRCm38)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,050,604 (GRCm38)	missense	probably benign
R4181:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,084,840 (GRCm38)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,102,099 (GRCm38)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,114,063 (GRCm38)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,072,880 (GRCm38)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,086,628 (GRCm38)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,069,963 (GRCm38)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,144,954 (GRCm38)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,078,791 (GRCm38)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,157,262 (GRCm38)	missense	probably benign
R4961:Piezo2	UTSW	18	63,052,961 (GRCm38)	splice site	probably null
R4968:Piezo2	UTSW	18	63,144,971 (GRCm38)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,074,680 (GRCm38)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,083,113 (GRCm38)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,024,536 (GRCm38)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,074,620 (GRCm38)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,030,409 (GRCm38)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,032,929 (GRCm38)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,064,731 (GRCm38)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,084,740 (GRCm38)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,145,105 (GRCm38)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,027,864 (GRCm38)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,011,721 (GRCm38)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,145,091 (GRCm38)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,117,697 (GRCm38)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,117,696 (GRCm38)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,146,856 (GRCm38)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,027,901 (GRCm38)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,113,934 (GRCm38)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,012,645 (GRCm38)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,157,210 (GRCm38)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,121,270 (GRCm38)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,117,678 (GRCm38)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,106,293 (GRCm38)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,086,607 (GRCm38)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,041,663 (GRCm38)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,106,271 (GRCm38)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,021,328 (GRCm38)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,021,262 (GRCm38)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,032,889 (GRCm38)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,090,879 (GRCm38)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,032,986 (GRCm38)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,082,961 (GRCm38)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,145,110 (GRCm38)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,124,709 (GRCm38)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,108,030 (GRCm38)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,017,519 (GRCm38)	splice site	probably null
R7395:Piezo2	UTSW	18	63,027,563 (GRCm38)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,024,472 (GRCm38)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,012,723 (GRCm38)	missense	probably benign
R7517:Piezo2	UTSW	18	63,082,925 (GRCm38)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,053,010 (GRCm38)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,042,539 (GRCm38)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,113,876 (GRCm38)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,082,945 (GRCm38)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,083,200 (GRCm38)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,042,811 (GRCm38)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,030,466 (GRCm38)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,075,730 (GRCm38)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,012,786 (GRCm38)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,084,688 (GRCm38)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,045,540 (GRCm38)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,146,802 (GRCm38)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,092,900 (GRCm38)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,093,015 (GRCm38)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8727:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8810:Piezo2	UTSW	18	63,114,963 (GRCm38)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,115,025 (GRCm38)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,092,831 (GRCm38)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,045,479 (GRCm38)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,117,744 (GRCm38)	missense	probably benign	0.03
R9209:Piezo2	UTSW	18	63,021,301 (GRCm38)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,075,797 (GRCm38)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,024,566 (GRCm38)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,029,085 (GRCm38)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,102,165 (GRCm38)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,386,276 (GRCm38)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,146,945 (GRCm38)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,115,037 (GRCm38)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,064,696 (GRCm38)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,027,586 (GRCm38)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,050,610 (GRCm38)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,017,577 (GRCm38)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,069,994 (GRCm38)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACATGTCAATCACCTGTGTCC -3'
(R):5'- ACCATACAGATGTGAGATAACTTCC -3'

Sequencing Primer
(F):5'- TGTGTCCTCATCTACAAGGTG -3'
(R):5'- AGATGTGAGATAACTTCCTCCCG -3'

Posted On

2022-02-07