Mutagenetix > Incidental Mutation

Incidental Mutation 'R9203:Sorcs1'

698354

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R9203 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50131737-50667084 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50250733 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 366 (I366T)

Ref Sequence

ENSEMBL: ENSMUSP00000147463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072685
AA Change: I366T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: I366T

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111756
AA Change: I366T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: I366T

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164039
AA Change: I366T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: I366T

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209413
AA Change: I366T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209783
AA Change: I366T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211008
AA Change: I366T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211687
AA Change: I366T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc1	T	C	2: 128,465,422 (GRCm39)	H1686R	possibly damaging	Het
Ankrd33b	A	G	15: 31,298,028 (GRCm39)	M243T	probably benign	Het
Appl1	G	T	14: 26,682,970 (GRCm39)	S104*	probably null	Het
Appl2	A	T	10: 83,476,879 (GRCm39)	Y48*	probably null	Het
Cacna1d	T	C	14: 29,773,669 (GRCm39)	N1694S	probably benign	Het
Cc2d2a	G	T	5: 43,891,179 (GRCm39)	D1372Y	probably benign	Het
Cdh4	C	T	2: 179,422,196 (GRCm39)	R107C	probably damaging	Het
Celsr1	G	T	15: 85,917,286 (GRCm39)	S229*	probably null	Het
Cfap54	T	G	10: 92,880,990 (GRCm39)	M358L	probably benign	Het
Csnka2ip	T	A	16: 64,298,630 (GRCm39)	D578V	unknown	Het
Ctns	T	C	11: 73,082,563 (GRCm39)	I56V	probably benign	Het
Dnah9	A	G	11: 65,746,113 (GRCm39)	I4000T	possibly damaging	Het
Dock2	A	G	11: 34,622,366 (GRCm39)	V91A	possibly damaging	Het
Dpep2	T	C	8: 106,712,885 (GRCm39)	H335R	probably damaging	Het
Eno1	C	T	4: 150,332,539 (GRCm39)	R400*	probably null	Het
Fam114a1	C	A	5: 65,137,300 (GRCm39)	P81H	probably damaging	Het
Gemin6	A	G	17: 80,535,237 (GRCm39)	T66A	probably benign	Het
Grm4	T	C	17: 27,653,980 (GRCm39)	I657V	probably benign	Het
H2ac22	T	C	13: 21,971,057 (GRCm39)	N111S	probably benign	Het
Has3	T	C	8: 107,600,852 (GRCm39)	C105R	probably damaging	Het
Hecw1	T	C	13: 14,491,243 (GRCm39)	E170G	probably benign	Het
Hoxd3	T	C	2: 74,576,744 (GRCm39)	V208A	probably damaging	Het
Hypk	C	T	2: 121,288,163 (GRCm39)	Q75*	probably null	Het
Itpkb	T	A	1: 180,161,004 (GRCm39)	W377R	probably benign	Het
Kbtbd2	A	T	6: 56,755,987 (GRCm39)	V583E	probably damaging	Het
Kdm5d	A	G	Y: 940,981 (GRCm39)	Y1122C	probably damaging	Het
Kif7	A	C	7: 79,354,472 (GRCm39)	L771R	probably damaging	Het
Krt9	C	G	11: 100,079,734 (GRCm39)	G553R	unknown	Het
Lama3	G	A	18: 12,595,869 (GRCm39)	A933T	probably benign	Het
Muc16	A	G	9: 18,462,984 (GRCm39)	I7406T	unknown	Het
Ndst4	C	T	3: 125,518,385 (GRCm39)	S354L	probably benign	Het
Ntng2	G	T	2: 29,084,998 (GRCm39)	C535*	probably null	Het
Omg	A	G	11: 79,393,051 (GRCm39)	M269T	probably benign	Het
Or1x6	A	T	11: 50,939,161 (GRCm39)	T76S	possibly damaging	Het
Or52e3	A	T	7: 102,869,862 (GRCm39)	*312C	probably null	Het
Parp2	T	C	14: 51,056,850 (GRCm39)	S325P	probably benign	Het
Pclo	C	T	5: 14,728,528 (GRCm39)	T2462M	unknown	Het
Pi4ka	G	T	16: 17,100,165 (GRCm39)	H1912N		Het
Piezo2	T	C	18: 63,290,302 (GRCm39)	I152M	probably benign	Het
Pigv	A	T	4: 133,392,990 (GRCm39)	L60Q	probably damaging	Het
Plcz1	T	A	6: 139,953,481 (GRCm39)	K379*	probably null	Het
Poll	T	C	19: 45,542,091 (GRCm39)	N405S	probably benign	Het
Pou6f2	T	A	13: 18,303,615 (GRCm39)	I467F		Het
Pramel11	T	A	4: 143,623,646 (GRCm39)	N176I	probably benign	Het
Psg26	T	C	7: 18,212,382 (GRCm39)	I324M	probably damaging	Het
Ptprh	T	A	7: 4,574,970 (GRCm39)	I350F	probably damaging	Het
Slpi	C	T	2: 164,196,817 (GRCm39)	V126I	probably benign	Het
Smarca5	C	T	8: 81,431,258 (GRCm39)	W986*	probably null	Het
Sv2c	G	T	13: 96,224,745 (GRCm39)	S188*	probably null	Het
Sycp2	T	C	2: 177,996,906 (GRCm39)	K1099R	probably damaging	Het
Tdp2	C	A	13: 25,020,916 (GRCm39)	Y178*	probably null	Het
Trabd2b	A	G	4: 114,460,122 (GRCm39)	E420G	probably damaging	Het
Uggt2	A	T	14: 119,294,975 (GRCm39)	H550Q	probably benign	Het
Vmn2r66	T	C	7: 84,654,950 (GRCm39)	K453R	probably benign	Het
Vsig10l	A	G	7: 43,112,657 (GRCm39)	M1V	probably null	Het
Wdr70	G	A	15: 7,902,684 (GRCm39)	S646L	probably benign	Het
Zfp219	A	T	14: 52,246,405 (GRCm39)	S241T	probably damaging	Het
Zfp24	G	A	18: 24,147,326 (GRCm39)	H329Y	probably damaging	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50,178,492 (GRCm39)	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50,164,566 (GRCm39)	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50,216,639 (GRCm39)	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50,276,517 (GRCm39)	splice site	probably benign
IGL01445:Sorcs1	APN	19	50,141,504 (GRCm39)	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50,169,944 (GRCm39)	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50,218,647 (GRCm39)	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50,276,597 (GRCm39)	splice site	probably benign
IGL02111:Sorcs1	APN	19	50,218,683 (GRCm39)	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50,322,036 (GRCm39)	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50,171,109 (GRCm39)	nonsense	probably null
IGL02498:Sorcs1	APN	19	50,666,606 (GRCm39)	missense	probably benign
IGL02658:Sorcs1	APN	19	50,178,530 (GRCm39)	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50,666,368 (GRCm39)	nonsense	probably null
IGL02942:Sorcs1	APN	19	50,463,875 (GRCm39)	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50,248,194 (GRCm39)	nonsense	probably null
IGL03230:Sorcs1	APN	19	50,230,531 (GRCm39)	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50,141,345 (GRCm39)	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50,367,329 (GRCm39)	splice site	probably benign
R0115:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50,301,480 (GRCm39)	splice site	probably null
R0481:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0581:Sorcs1	UTSW	19	50,241,139 (GRCm39)	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50,230,380 (GRCm39)	splice site	probably benign
R0980:Sorcs1	UTSW	19	50,220,761 (GRCm39)	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50,132,598 (GRCm39)	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50,241,025 (GRCm39)	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50,463,860 (GRCm39)	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50,163,481 (GRCm39)	splice site	probably benign
R1783:Sorcs1	UTSW	19	50,216,747 (GRCm39)	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50,210,633 (GRCm39)	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50,666,630 (GRCm39)	missense	probably benign
R2206:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50,199,088 (GRCm39)	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50,139,659 (GRCm39)	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50,210,597 (GRCm39)	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50,178,599 (GRCm39)	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50,367,379 (GRCm39)	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50,301,402 (GRCm39)	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50,171,107 (GRCm39)	missense	probably benign
R4780:Sorcs1	UTSW	19	50,132,419 (GRCm39)	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50,171,119 (GRCm39)	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50,218,740 (GRCm39)	missense	possibly damaging	0.87
R4823:Sorcs1	UTSW	19	50,666,578 (GRCm39)	missense	possibly damaging	0.92
R4883:Sorcs1	UTSW	19	50,220,741 (GRCm39)	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50,213,579 (GRCm39)	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50,241,040 (GRCm39)	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50,210,571 (GRCm39)	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50,171,213 (GRCm39)	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50,178,555 (GRCm39)	nonsense	probably null
R6091:Sorcs1	UTSW	19	50,276,539 (GRCm39)	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50,276,532 (GRCm39)	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50,169,852 (GRCm39)	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50,132,562 (GRCm39)	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50,213,615 (GRCm39)	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50,164,560 (GRCm39)	nonsense	probably null
R6792:Sorcs1	UTSW	19	50,666,606 (GRCm39)	missense	probably benign
R6891:Sorcs1	UTSW	19	50,213,557 (GRCm39)	nonsense	probably null
R7151:Sorcs1	UTSW	19	50,301,420 (GRCm39)	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50,178,480 (GRCm39)	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50,163,595 (GRCm39)	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50,250,701 (GRCm39)	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50,141,550 (GRCm39)	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50,141,490 (GRCm39)	missense	probably benign
R7506:Sorcs1	UTSW	19	50,171,112 (GRCm39)	nonsense	probably null
R7573:Sorcs1	UTSW	19	50,141,234 (GRCm39)	nonsense	probably null
R7867:Sorcs1	UTSW	19	50,218,698 (GRCm39)	nonsense	probably null
R7911:Sorcs1	UTSW	19	50,132,470 (GRCm39)	missense	unknown
R8032:Sorcs1	UTSW	19	50,463,846 (GRCm39)	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50,132,415 (GRCm39)	missense	unknown
R8463:Sorcs1	UTSW	19	50,248,248 (GRCm39)	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50,367,398 (GRCm39)	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50,139,658 (GRCm39)	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50,241,096 (GRCm39)	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50,213,658 (GRCm39)	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50,220,753 (GRCm39)	missense	possibly damaging	0.92
R9229:Sorcs1	UTSW	19	50,141,300 (GRCm39)	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50,213,651 (GRCm39)	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50,199,208 (GRCm39)	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50,215,275 (GRCm39)	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50,171,201 (GRCm39)	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50,210,581 (GRCm39)	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50,322,037 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs1	UTSW	19	50,215,180 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACAGCCTGTGAGCATCC -3'
(R):5'- TTAGTGGGCACTTGGAGAGC -3'

Sequencing Primer
(F):5'- TGTGAGCATCCCTCCCCG -3'
(R):5'- AGCGTGTGAGACTTGCTTGAAC -3'

Posted On

2022-02-07