Incidental Mutation 'R9204:Angptl2'
ID 698362
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Name angiopoietin-like 2
Synonyms Arp2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 33216069-33247717 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33228330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 39 (I39F)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
AlphaFold Q9R045
Predicted Effect probably benign
Transcript: ENSMUST00000004208
AA Change: I39F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: I39F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193373
AA Change: I39F

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105
AA Change: I39F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
Grazie UTSW 2 33243910 nonsense probably null
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
R8719:Angptl2 UTSW 2 33243902 missense possibly damaging 0.74
R8927:Angptl2 UTSW 2 33242304 missense probably benign 0.35
R8928:Angptl2 UTSW 2 33242304 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGTATTTGGGGAACGTCCTAC -3'
(R):5'- CATTGTTGAGCAGCTCCAGC -3'

Sequencing Primer
(F):5'- ATGGGGCTGTCACTGACCTTATC -3'
(R):5'- CTCCTGCTTGTGCACACGG -3'
Posted On 2022-02-07