Incidental Mutation 'R9204:Olfr1257'
ID 698363
Institutional Source Beutler Lab
Gene Symbol Olfr1257
Ensembl Gene ENSMUSG00000049057
Gene Name olfactory receptor 1257
Synonyms MOR232-1, GA_x6K02T2Q125-51319458-51320387
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89878437-89883026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 89881138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 104 (L104W)
Ref Sequence ENSEMBL: ENSMUSP00000107144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060795] [ENSMUST00000111519]
AlphaFold Q8VGP0
Predicted Effect probably damaging
Transcript: ENSMUST00000060795
AA Change: L104W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056439
Gene: ENSMUSG00000049057
AA Change: L104W

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.6e-31 PFAM
Pfam:7tm_4 137 278 8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111519
AA Change: L104W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107144
Gene: ENSMUSG00000049057
AA Change: L104W

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 3.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Olfr1257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Olfr1257 APN 2 89881662 missense probably benign 0.02
IGL01641:Olfr1257 APN 2 89881608 missense probably benign 0.01
IGL01668:Olfr1257 APN 2 89881099 missense probably benign 0.01
IGL01901:Olfr1257 APN 2 89881482 missense probably damaging 1.00
IGL02401:Olfr1257 APN 2 89881453 missense probably damaging 1.00
IGL02472:Olfr1257 APN 2 89881411 missense probably benign 0.44
IGL02631:Olfr1257 APN 2 89881255 missense possibly damaging 0.95
PIT4354001:Olfr1257 UTSW 2 89881508 missense probably benign 0.04
R0552:Olfr1257 UTSW 2 89880891 nonsense probably null
R0616:Olfr1257 UTSW 2 89881591 missense probably benign 0.07
R0943:Olfr1257 UTSW 2 89880961 missense probably benign 0.11
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1314:Olfr1257 UTSW 2 89880877 missense probably benign 0.35
R1641:Olfr1257 UTSW 2 89881401 missense probably benign 0.07
R1763:Olfr1257 UTSW 2 89881129 missense probably damaging 0.99
R1836:Olfr1257 UTSW 2 89881285 missense probably damaging 1.00
R2125:Olfr1257 UTSW 2 89881638 missense probably benign
R4322:Olfr1257 UTSW 2 89881734 missense probably benign 0.07
R4897:Olfr1257 UTSW 2 89881132 missense probably benign 0.39
R5446:Olfr1257 UTSW 2 89881549 missense probably damaging 1.00
R5456:Olfr1257 UTSW 2 89881258 missense probably damaging 0.97
R6415:Olfr1257 UTSW 2 89880862 missense probably damaging 1.00
R6905:Olfr1257 UTSW 2 89881708 missense probably benign 0.05
R7170:Olfr1257 UTSW 2 89880841 missense probably benign 0.12
R7170:Olfr1257 UTSW 2 89881053 missense possibly damaging 0.70
R7411:Olfr1257 UTSW 2 89881261 missense probably damaging 0.98
R8171:Olfr1257 UTSW 2 89881065 missense probably benign 0.05
R8490:Olfr1257 UTSW 2 89881167 missense probably damaging 1.00
R9176:Olfr1257 UTSW 2 89881171 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTGCTCATTGTGGTCACC -3'
(R):5'- GATCTATGATGTTAGGGCCACAG -3'

Sequencing Primer
(F):5'- GTGCTCATTGTGGTCACCATAAC -3'
(R):5'- CTATGATGTTAGGGCCACAGAAGGG -3'
Posted On 2022-02-07