Incidental Mutation 'R9204:Flnc'
ID 698374
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Name filamin C, gamma
Synonyms 1110055E19Rik, actin binding protein 280, Fln2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 29433256-29461883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 29452354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1726 (I1726L)
Ref Sequence ENSEMBL: ENSMUSP00000064163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000065090
AA Change: I1726L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: I1726L

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101617
AA Change: I1726L

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: I1726L

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0748:Flnc UTSW 6 29446344 missense probably damaging 0.99
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2016:Flnc UTSW 6 29443797 critical splice donor site probably null
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5174:Flnc UTSW 6 29448894 missense possibly damaging 0.91
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6717:Flnc UTSW 6 29450902 small deletion probably benign
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
R7413:Flnc UTSW 6 29452259 missense probably damaging 1.00
R7422:Flnc UTSW 6 29455471 missense probably damaging 1.00
R7559:Flnc UTSW 6 29459010 missense probably damaging 1.00
R7632:Flnc UTSW 6 29446985 missense probably damaging 0.98
R7651:Flnc UTSW 6 29444050 missense probably benign 0.08
R7679:Flnc UTSW 6 29456790 missense probably benign 0.00
R7697:Flnc UTSW 6 29456517 missense probably damaging 0.98
R7788:Flnc UTSW 6 29456444 missense possibly damaging 0.67
R7852:Flnc UTSW 6 29440898 missense probably damaging 1.00
R7870:Flnc UTSW 6 29454307 missense probably damaging 1.00
R7873:Flnc UTSW 6 29456991 missense possibly damaging 0.88
R7921:Flnc UTSW 6 29447770 missense possibly damaging 0.58
R7950:Flnc UTSW 6 29456382 missense possibly damaging 0.61
R7953:Flnc UTSW 6 29447829 missense probably damaging 0.99
R7970:Flnc UTSW 6 29447526 missense possibly damaging 0.96
R8071:Flnc UTSW 6 29457446 missense probably damaging 1.00
R8143:Flnc UTSW 6 29441485 missense probably benign 0.20
R8166:Flnc UTSW 6 29433732 missense probably damaging 0.99
R8167:Flnc UTSW 6 29455922 missense probably damaging 0.98
R8306:Flnc UTSW 6 29449370 missense probably benign 0.05
R8428:Flnc UTSW 6 29450850 missense probably benign 0.36
R8466:Flnc UTSW 6 29438622 missense probably damaging 0.98
R8671:Flnc UTSW 6 29443502 critical splice donor site probably null
R8885:Flnc UTSW 6 29455411 missense probably damaging 0.96
R8922:Flnc UTSW 6 29456836 missense probably damaging 0.99
R8923:Flnc UTSW 6 29452237 missense probably damaging 1.00
R8985:Flnc UTSW 6 29440500 missense probably benign 0.37
R9075:Flnc UTSW 6 29447647 missense probably damaging 0.96
R9098:Flnc UTSW 6 29455519 nonsense probably null
R9162:Flnc UTSW 6 29455861 missense probably damaging 1.00
R9199:Flnc UTSW 6 29441491 missense probably benign 0.31
R9273:Flnc UTSW 6 29447816 missense probably benign 0.08
R9411:Flnc UTSW 6 29441485 missense probably benign
R9412:Flnc UTSW 6 29441485 missense probably benign
R9413:Flnc UTSW 6 29441485 missense probably benign
R9451:Flnc UTSW 6 29445463 missense probably damaging 0.98
R9524:Flnc UTSW 6 29461110 missense probably damaging 1.00
R9575:Flnc UTSW 6 29454400 missense probably damaging 0.98
R9582:Flnc UTSW 6 29460737 missense probably damaging 0.99
R9595:Flnc UTSW 6 29433721 missense probably benign 0.05
R9664:Flnc UTSW 6 29457215 missense probably damaging 1.00
R9665:Flnc UTSW 6 29455448 missense probably damaging 1.00
R9686:Flnc UTSW 6 29456435 missense possibly damaging 0.84
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Z1177:Flnc UTSW 6 29447545 missense probably damaging 1.00
Z1177:Flnc UTSW 6 29457130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCCCAGAATCCAGATC -3'
(R):5'- CCCAAGGGCTCATTCTAGAG -3'

Sequencing Primer
(F):5'- TGTGATCACAGTGGACGC -3'
(R):5'- CAAGGGCTCATTCTAGAGTACTCTG -3'
Posted On 2022-02-07