Incidental Mutation 'R9204:Aadat'
ID 698384
Institutional Source Beutler Lab
Gene Symbol Aadat
Ensembl Gene ENSMUSG00000057228
Gene Name aminoadipate aminotransferase
Synonyms KATII, Kat2, mKat-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 60505932-60545677 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60543532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 389 (V389A)
Ref Sequence ENSEMBL: ENSMUSP00000148060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079472] [ENSMUST00000209338]
AlphaFold Q9WVM8
Predicted Effect probably benign
Transcript: ENSMUST00000079472
AA Change: V382A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078436
Gene: ENSMUSG00000057228
AA Change: V382A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 417 2.6e-22 PFAM
Pfam:Aminotran_MocR 124 424 7.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209338
AA Change: V389A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are viable and display earlier eye opening and development of air righting and open field crossing responses, and transient hyperactivity and neuronal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Aadat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Aadat APN 8 60535758 missense probably benign 0.11
IGL01123:Aadat APN 8 60526614 missense probably benign 0.14
IGL01524:Aadat APN 8 60516072 missense probably damaging 0.97
IGL01767:Aadat APN 8 60507092 missense probably damaging 0.96
IGL02824:Aadat APN 8 60516022 missense probably benign 0.01
IGL03150:Aadat APN 8 60543562 missense probably damaging 0.97
IGL03356:Aadat APN 8 60531691 missense probably damaging 1.00
R0015:Aadat UTSW 8 60534571 splice site probably benign
R0294:Aadat UTSW 8 60534608 missense possibly damaging 0.77
R0533:Aadat UTSW 8 60531763 splice site probably benign
R0631:Aadat UTSW 8 60529445 splice site probably benign
R1585:Aadat UTSW 8 60526680 missense possibly damaging 0.67
R1728:Aadat UTSW 8 60526712 missense probably damaging 1.00
R1729:Aadat UTSW 8 60526712 missense probably damaging 1.00
R2051:Aadat UTSW 8 60507139 missense probably benign 0.00
R2362:Aadat UTSW 8 60532298 splice site probably benign
R3971:Aadat UTSW 8 60518581 missense probably damaging 1.00
R4126:Aadat UTSW 8 60531669 missense probably benign 0.00
R4736:Aadat UTSW 8 60540106 missense probably benign 0.30
R4739:Aadat UTSW 8 60540106 missense probably benign 0.30
R4750:Aadat UTSW 8 60526600 missense probably benign 0.10
R4874:Aadat UTSW 8 60516113 critical splice donor site probably null
R4884:Aadat UTSW 8 60526629 missense probably damaging 1.00
R5233:Aadat UTSW 8 60526622 missense probably benign 0.01
R5367:Aadat UTSW 8 60526596 missense probably damaging 1.00
R6920:Aadat UTSW 8 60529433 missense probably damaging 0.97
R7064:Aadat UTSW 8 60531712 missense probably damaging 1.00
R7194:Aadat UTSW 8 60526622 missense probably benign 0.01
R7316:Aadat UTSW 8 60526634 missense probably damaging 0.98
R7634:Aadat UTSW 8 60516068 missense probably benign 0.09
R8672:Aadat UTSW 8 60506145 unclassified probably benign
R8711:Aadat UTSW 8 60516086 missense probably benign 0.01
R8803:Aadat UTSW 8 60545256 missense probably benign 0.14
R8919:Aadat UTSW 8 60540124 missense possibly damaging 0.94
R9207:Aadat UTSW 8 60526623 missense probably damaging 1.00
R9313:Aadat UTSW 8 60526601 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGTTTGTCTAGAGCATGCCATATG -3'
(R):5'- CTGTATCCATCTGTGCTGGAG -3'

Sequencing Primer
(F):5'- GAGCATGCCATATGTATTTTTATGTG -3'
(R):5'- TAGCCAGAGAGAAGAATGCTCTG -3'
Posted On 2022-02-07