Incidental Mutation 'R9204:Ccdc33'
ID 698389
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 58028677-58118823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58031105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 861 (V861A)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034874
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042205
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: V861A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: V861A

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
R9139:Ccdc33 UTSW 9 58076559 missense probably benign 0.04
R9280:Ccdc33 UTSW 9 58058266 missense probably benign
R9297:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58117625 missense possibly damaging 0.96
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATACATGGTATGTGGTTAAACTGGAGG -3'
(R):5'- ACCTTCTGGGATTGGTGCAG -3'

Sequencing Primer
(F):5'- GGTCTTTTGTAGCATAAAGGCTCATC -3'
(R):5'- AGCCTTGGAGAGCCCTTTTC -3'
Posted On 2022-02-07