Incidental Mutation 'R9204:Nphp3'
ID 698392
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104042106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1318 (V1318I)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774] [ENSMUST00000216593]
AlphaFold Q7TNH6
Predicted Effect probably benign
Transcript: ENSMUST00000035166
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: V1318I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: V1318I

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194183
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: V1198I
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: V1198I

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216593
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9135:Nphp3 UTSW 9 104032015 missense probably damaging 0.99
R9159:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9226:Nphp3 UTSW 9 104008129 missense probably benign 0.00
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGTGCATCTCTCATGTTG -3'
(R):5'- GAGTGCTGATGTCGTCATCC -3'

Sequencing Primer
(F):5'- GTTTCCTCTCAAAGCTATGAAGAAGG -3'
(R):5'- CCCATAGGAAACAGGTTCTTTAATC -3'
Posted On 2022-02-07