Incidental Mutation 'R9204:Olfr826'
ID 698394
Institutional Source Beutler Lab
Gene Symbol Olfr826
Ensembl Gene ENSMUSG00000059862
Gene Name olfactory receptor 826
Synonyms MOR210-2, GA_x6K02T2PULF-11851623-11850682
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 130178471-130184186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 130180697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 61 (P61R)
Ref Sequence ENSEMBL: ENSMUSP00000149119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078322] [ENSMUST00000203720] [ENSMUST00000216661]
AlphaFold Q8VFU6
Predicted Effect probably damaging
Transcript: ENSMUST00000078322
AA Change: P61R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077436
Gene: ENSMUSG00000059862
AA Change: P61R

DomainStartEndE-ValueType
Pfam:7tm_4 34 309 2.3e-52 PFAM
Pfam:7tm_1 44 291 3.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203720
AA Change: P61R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144755
Gene: ENSMUSG00000059862
AA Change: P61R

DomainStartEndE-ValueType
Pfam:7tm_4 34 309 2.3e-52 PFAM
Pfam:7tm_1 44 291 3.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216661
AA Change: P61R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Prr3 T A 17: 35,974,727 I88F possibly damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Olfr826
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Olfr826 APN 10 130180214 missense probably benign 0.06
R0627:Olfr826 UTSW 10 130180688 missense probably damaging 1.00
R1672:Olfr826 UTSW 10 130180392 missense probably benign 0.00
R1834:Olfr826 UTSW 10 130180832 missense probably benign 0.01
R1957:Olfr826 UTSW 10 130179978 missense possibly damaging 0.77
R3717:Olfr826 UTSW 10 130180500 missense possibly damaging 0.63
R5106:Olfr826 UTSW 10 130180308 missense probably benign 0.37
R5837:Olfr826 UTSW 10 130180397 missense probably damaging 1.00
R6348:Olfr826 UTSW 10 130180297 missense probably benign 0.12
R6971:Olfr826 UTSW 10 130180769 missense possibly damaging 0.95
R7181:Olfr826 UTSW 10 130180757 missense possibly damaging 0.78
R7394:Olfr826 UTSW 10 130180254 missense probably damaging 1.00
R8372:Olfr826 UTSW 10 130180787 missense probably damaging 0.99
R8429:Olfr826 UTSW 10 130180223 missense possibly damaging 0.87
R8679:Olfr826 UTSW 10 130180833 missense probably benign 0.01
R8746:Olfr826 UTSW 10 130180217 missense probably damaging 1.00
R9043:Olfr826 UTSW 10 130180285 missense probably benign 0.00
R9254:Olfr826 UTSW 10 130180736 missense possibly damaging 0.85
R9379:Olfr826 UTSW 10 130180736 missense possibly damaging 0.85
R9568:Olfr826 UTSW 10 130179945 missense probably benign
Z1176:Olfr826 UTSW 10 130179965 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCAATGAAACGGTCATAAGCC -3'
(R):5'- CTCATCAGGTCTCTTCCATGGG -3'

Sequencing Primer
(F):5'- ACGGTCATAAGCCATGGC -3'
(R):5'- TCTCTTCCATGGGCGACAG -3'
Posted On 2022-02-07