Incidental Mutation 'R9204:Prr3'
ID 698405
Institutional Source Beutler Lab
Gene Symbol Prr3
Ensembl Gene ENSMUSG00000038500
Gene Name proline-rich polypeptide 3
Synonyms 4930540G07Rik, CAT56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R9204 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35972541-35980236 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35974727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 88 (I88F)
Ref Sequence ENSEMBL: ENSMUSP00000052166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043757] [ENSMUST00000055454] [ENSMUST00000165613] [ENSMUST00000172429] [ENSMUST00000172661] [ENSMUST00000172900] [ENSMUST00000173585] [ENSMUST00000173724] [ENSMUST00000173872] [ENSMUST00000174849]
AlphaFold Q811B5
Predicted Effect probably benign
Transcript: ENSMUST00000043757
SMART Domains Protein: ENSMUSP00000036881
Gene: ENSMUSG00000038762

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
coiled coil region 46 79 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
low complexity region 218 234 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
AAA 320 524 9e-10 SMART
low complexity region 529 554 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
AAA 642 807 1.11e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000055454
AA Change: I88F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052166
Gene: ENSMUSG00000038500
AA Change: I88F

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 48 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
low complexity region 110 120 N/A INTRINSIC
ZnF_C3H1 158 184 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165613
SMART Domains Protein: ENSMUSP00000125802
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172429
AA Change: I41F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129651
Gene: ENSMUSG00000038500
AA Change: I41F

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
ZnF_C3H1 111 137 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172661
Predicted Effect probably benign
Transcript: ENSMUST00000172900
SMART Domains Protein: ENSMUSP00000134115
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173585
AA Change: I41F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134373
Gene: ENSMUSG00000038500
AA Change: I41F

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
ZnF_C3H1 111 137 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173724
Predicted Effect probably benign
Transcript: ENSMUST00000173872
SMART Domains Protein: ENSMUSP00000134021
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174849
SMART Domains Protein: ENSMUSP00000134505
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,160 I257L unknown Het
9930021J03Rik A G 19: 29,719,538 S852P possibly damaging Het
Aadat T C 8: 60,543,532 V389A possibly damaging Het
Adgrl1 T C 8: 83,933,890 F792S probably benign Het
Angptl2 A T 2: 33,228,330 I39F probably benign Het
Aprt A G 8: 122,576,616 I29T probably damaging Het
Arhgap21 A T 2: 20,881,005 S464T probably damaging Het
Atic T C 1: 71,564,477 Y151H probably damaging Het
BB014433 T C 8: 15,042,623 T77A unknown Het
Boc C A 16: 44,487,714 C926F Het
Cabin1 C T 10: 75,694,716 R1544Q probably benign Het
Ccdc33 A G 9: 58,031,105 V861A probably benign Het
Ccdc88c T C 12: 100,938,063 T230A unknown Het
Cdc42bpa T A 1: 180,111,895 probably null Het
Chrnb2 T C 3: 89,760,821 M396V probably benign Het
Chst2 A G 9: 95,405,102 V397A probably damaging Het
Cit T A 5: 115,988,439 N1643K probably damaging Het
Ckb T A 12: 111,671,435 D113V probably benign Het
Cyp2c68 A T 19: 39,739,127 M136K probably damaging Het
Epas1 G T 17: 86,809,445 R181L probably damaging Het
Flnc A C 6: 29,452,354 I1726L possibly damaging Het
Fras1 G A 5: 96,735,163 R2518H probably damaging Het
Gid4 T C 11: 60,417,828 V58A probably benign Het
Hmcn1 T A 1: 150,734,511 N1469I probably benign Het
Hmcn2 A G 2: 31,388,365 E1693G probably damaging Het
Irx4 C G 13: 73,268,530 C348W probably damaging Het
Lrig2 A G 3: 104,480,122 S410P possibly damaging Het
Lsm11 A G 11: 45,933,962 V246A probably benign Het
Ltbp1 G T 17: 75,363,430 V1489F probably damaging Het
Mc2r T C 18: 68,407,596 T209A probably benign Het
Mms22l T C 4: 24,581,153 L821P probably damaging Het
Mtus2 A T 5: 148,301,483 E1206V probably damaging Het
Muc5b T A 7: 141,856,392 H1234Q unknown Het
Naip5 A T 13: 100,222,500 F743I probably damaging Het
Nphp3 G A 9: 104,042,106 V1318I probably benign Het
Olfr1257 T G 2: 89,881,138 L104W probably damaging Het
Olfr484 A T 7: 108,124,728 N178K possibly damaging Het
Olfr628 A G 7: 103,732,849 K308E possibly damaging Het
Olfr826 G C 10: 130,180,697 P61R probably damaging Het
Olfr844 T C 9: 19,318,699 L61P probably damaging Het
Olfr878 C A 9: 37,919,374 T239K probably damaging Het
Paqr5 G A 9: 61,961,544 R246C probably benign Het
Pdgfb T C 15: 80,001,755 Q128R probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
R3hcc1l G A 19: 42,563,862 D433N probably benign Het
Scnn1b A T 7: 121,899,299 T21S probably benign Het
Smcr8 A G 11: 60,778,031 I2V probably damaging Het
Stk33 T C 7: 109,341,479 D8G probably benign Het
Tbc1d22a T C 15: 86,214,602 F10L probably benign Het
Tmem126a T A 7: 90,452,818 I58F possibly damaging Het
Ttf2 T C 3: 100,962,564 K398E probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp53 G T 3: 122,947,419 N727K probably benign Het
Vmn2r25 T G 6: 123,853,133 I20L probably benign Het
Other mutations in Prr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1641:Prr3 UTSW 17 35974592 nonsense probably null
R6033:Prr3 UTSW 17 35978624 splice site probably null
R8052:Prr3 UTSW 17 35979161 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGTGCTTCTCAGTGAGAGCC -3'
(R):5'- TAAAAGTCCTGTGTCCGTGC -3'

Sequencing Primer
(F):5'- TTCTCAGTGAGAGCCCAGAG -3'
(R):5'- CCGTGCTTTGCTGTTGTAAGC -3'
Posted On 2022-02-07