Incidental Mutation 'R9205:Igfn1'
ID 698415
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Name immunoglobulin-like and fibronectin type III domain containing 1
Synonyms 9830123M21Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 135881316-135934080 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 135903695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 348 (V348I)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000124134
AA Change: V227I

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: V227I

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166193
AA Change: V348I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: V348I

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135,894,464 (GRCm39) missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135,881,755 (GRCm39) utr 3 prime probably benign
Bounty UTSW 1 135,904,655 (GRCm39) critical splice donor site probably null
R2276_Igfn1_773 UTSW 1 135,892,479 (GRCm39) missense probably damaging 0.98
R4058_Igfn1_315 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R0144:Igfn1 UTSW 1 135,889,751 (GRCm39) missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135,889,790 (GRCm39) missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135,884,505 (GRCm39) nonsense probably null
R0413:Igfn1 UTSW 1 135,895,334 (GRCm39) missense probably benign 0.23
R0504:Igfn1 UTSW 1 135,896,267 (GRCm39) missense probably benign 0.00
R0606:Igfn1 UTSW 1 135,887,639 (GRCm39) missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135,891,591 (GRCm39) missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135,890,864 (GRCm39) missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135,882,418 (GRCm39) missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135,898,463 (GRCm39) missense probably benign
R1078:Igfn1 UTSW 1 135,902,585 (GRCm39) missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R1569:Igfn1 UTSW 1 135,896,771 (GRCm39) missense probably benign
R1626:Igfn1 UTSW 1 135,896,705 (GRCm39) missense probably benign 0.29
R1663:Igfn1 UTSW 1 135,896,046 (GRCm39) missense probably benign 0.15
R1677:Igfn1 UTSW 1 135,898,839 (GRCm39) missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135,883,311 (GRCm39) missense probably benign 0.24
R1728:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1728:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1728:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1728:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1729:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1729:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1729:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1730:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1730:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1739:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1739:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1739:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1746:Igfn1 UTSW 1 135,897,561 (GRCm39) missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1762:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1762:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1783:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1783:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1783:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1783:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1784:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1784:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1784:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135,926,421 (GRCm39) missense unknown
R1785:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,910,213 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,907,653 (GRCm39) missense probably benign 0.00
R1785:Igfn1 UTSW 1 135,899,865 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,898,149 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,895,937 (GRCm39) missense probably benign
R1785:Igfn1 UTSW 1 135,887,666 (GRCm39) missense probably damaging 1.00
R1847:Igfn1 UTSW 1 135,897,126 (GRCm39) missense probably benign
R1866:Igfn1 UTSW 1 135,902,606 (GRCm39) splice site probably null
R1921:Igfn1 UTSW 1 135,893,801 (GRCm39) critical splice donor site probably null
R1984:Igfn1 UTSW 1 135,889,782 (GRCm39) missense probably benign 0.39
R2049:Igfn1 UTSW 1 135,902,590 (GRCm39) splice site probably benign
R2049:Igfn1 UTSW 1 135,898,376 (GRCm39) missense probably benign
R2098:Igfn1 UTSW 1 135,906,043 (GRCm39) missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135,902,590 (GRCm39) splice site probably benign
R2141:Igfn1 UTSW 1 135,902,590 (GRCm39) splice site probably benign
R2276:Igfn1 UTSW 1 135,892,479 (GRCm39) missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135,890,840 (GRCm39) missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135,897,275 (GRCm39) missense probably benign
R2504:Igfn1 UTSW 1 135,897,054 (GRCm39) missense probably benign 0.07
R3109:Igfn1 UTSW 1 135,925,586 (GRCm39) missense probably benign 0.12
R3421:Igfn1 UTSW 1 135,904,655 (GRCm39) critical splice donor site probably null
R3423:Igfn1 UTSW 1 135,926,379 (GRCm39) missense probably benign 0.01
R3705:Igfn1 UTSW 1 135,896,147 (GRCm39) missense probably benign
R3871:Igfn1 UTSW 1 135,896,574 (GRCm39) missense probably benign 0.03
R3875:Igfn1 UTSW 1 135,882,352 (GRCm39) missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135,894,918 (GRCm39) missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135,894,918 (GRCm39) missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135,894,918 (GRCm39) missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135,895,557 (GRCm39) missense probably benign
R4006:Igfn1 UTSW 1 135,910,100 (GRCm39) splice site probably null
R4058:Igfn1 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R4059:Igfn1 UTSW 1 135,897,494 (GRCm39) missense probably benign 0.07
R4370:Igfn1 UTSW 1 135,895,844 (GRCm39) missense probably benign 0.00
R4380:Igfn1 UTSW 1 135,895,509 (GRCm39) missense probably benign 0.00
R4495:Igfn1 UTSW 1 135,897,416 (GRCm39) missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135,887,468 (GRCm39) missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135,893,107 (GRCm39) missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135,926,363 (GRCm39) missense probably benign
R4702:Igfn1 UTSW 1 135,894,947 (GRCm39) missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135,910,196 (GRCm39) missense probably benign 0.07
R4777:Igfn1 UTSW 1 135,882,600 (GRCm39) missense probably benign
R4806:Igfn1 UTSW 1 135,895,095 (GRCm39) missense probably benign 0.01
R4840:Igfn1 UTSW 1 135,895,778 (GRCm39) missense probably benign 0.00
R4894:Igfn1 UTSW 1 135,882,520 (GRCm39) missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135,882,404 (GRCm39) missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135,892,564 (GRCm39) missense probably benign
R5108:Igfn1 UTSW 1 135,910,179 (GRCm39) missense probably benign
R5120:Igfn1 UTSW 1 135,901,240 (GRCm39) missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135,887,634 (GRCm39) missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135,894,474 (GRCm39) missense probably benign 0.26
R5286:Igfn1 UTSW 1 135,895,599 (GRCm39) missense probably benign 0.10
R5307:Igfn1 UTSW 1 135,892,676 (GRCm39) missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135,893,825 (GRCm39) missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135,895,622 (GRCm39) missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135,898,152 (GRCm39) missense probably benign 0.01
R5779:Igfn1 UTSW 1 135,894,578 (GRCm39) missense probably benign 0.16
R5818:Igfn1 UTSW 1 135,893,864 (GRCm39) missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135,902,533 (GRCm39) missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135,898,341 (GRCm39) nonsense probably null
R5966:Igfn1 UTSW 1 135,893,152 (GRCm39) missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135,898,205 (GRCm39) missense probably benign 0.00
R6297:Igfn1 UTSW 1 135,892,399 (GRCm39) critical splice donor site probably null
R6652:Igfn1 UTSW 1 135,891,609 (GRCm39) missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135,897,605 (GRCm39) missense probably benign
R6816:Igfn1 UTSW 1 135,887,466 (GRCm39) missense probably benign 0.02
R6886:Igfn1 UTSW 1 135,901,198 (GRCm39) missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135,910,218 (GRCm39) missense probably benign 0.33
R6975:Igfn1 UTSW 1 135,896,183 (GRCm39) missense probably damaging 0.96
R7105:Igfn1 UTSW 1 135,911,956 (GRCm39) missense probably benign 0.11
R7114:Igfn1 UTSW 1 135,894,519 (GRCm39) missense probably benign 0.01
R7233:Igfn1 UTSW 1 135,897,873 (GRCm39) missense probably benign 0.41
R7276:Igfn1 UTSW 1 135,926,376 (GRCm39) missense possibly damaging 0.85
R7354:Igfn1 UTSW 1 135,903,770 (GRCm39) missense possibly damaging 0.72
R7358:Igfn1 UTSW 1 135,891,738 (GRCm39) missense probably damaging 1.00
R7380:Igfn1 UTSW 1 135,889,746 (GRCm39) missense probably damaging 1.00
R7389:Igfn1 UTSW 1 135,894,785 (GRCm39) missense probably benign 0.00
R7513:Igfn1 UTSW 1 135,887,705 (GRCm39) missense probably damaging 1.00
R7718:Igfn1 UTSW 1 135,896,774 (GRCm39) missense probably benign
R7769:Igfn1 UTSW 1 135,910,143 (GRCm39) missense possibly damaging 0.85
R7810:Igfn1 UTSW 1 135,902,527 (GRCm39) missense probably damaging 0.98
R7917:Igfn1 UTSW 1 135,899,706 (GRCm39) missense probably damaging 0.99
R7952:Igfn1 UTSW 1 135,891,693 (GRCm39) missense probably damaging 0.99
R8041:Igfn1 UTSW 1 135,895,797 (GRCm39) nonsense probably null
R8233:Igfn1 UTSW 1 135,895,782 (GRCm39) missense probably benign 0.00
R8354:Igfn1 UTSW 1 135,887,619 (GRCm39) missense possibly damaging 0.61
R8363:Igfn1 UTSW 1 135,891,625 (GRCm39) missense probably benign 0.01
R8428:Igfn1 UTSW 1 135,895,520 (GRCm39) missense probably damaging 1.00
R8731:Igfn1 UTSW 1 135,925,574 (GRCm39) missense probably benign 0.02
R8756:Igfn1 UTSW 1 135,895,698 (GRCm39) missense probably benign 0.10
R8797:Igfn1 UTSW 1 135,902,573 (GRCm39) missense possibly damaging 0.93
R8913:Igfn1 UTSW 1 135,891,579 (GRCm39) missense possibly damaging 0.90
R8927:Igfn1 UTSW 1 135,905,984 (GRCm39) missense probably damaging 1.00
R8928:Igfn1 UTSW 1 135,905,984 (GRCm39) missense probably damaging 1.00
R9087:Igfn1 UTSW 1 135,902,606 (GRCm39) splice site probably null
R9109:Igfn1 UTSW 1 135,926,327 (GRCm39) missense probably benign 0.26
R9113:Igfn1 UTSW 1 135,883,328 (GRCm39) missense probably damaging 1.00
R9117:Igfn1 UTSW 1 135,902,528 (GRCm39) missense probably benign 0.03
R9251:Igfn1 UTSW 1 135,894,409 (GRCm39) splice site probably benign
R9260:Igfn1 UTSW 1 135,907,694 (GRCm39) missense probably benign 0.45
R9275:Igfn1 UTSW 1 135,901,185 (GRCm39) missense probably damaging 0.96
R9277:Igfn1 UTSW 1 135,887,520 (GRCm39) missense probably damaging 0.98
R9278:Igfn1 UTSW 1 135,901,185 (GRCm39) missense probably damaging 0.96
R9287:Igfn1 UTSW 1 135,925,544 (GRCm39) missense probably benign 0.33
R9298:Igfn1 UTSW 1 135,926,327 (GRCm39) missense probably benign 0.26
R9356:Igfn1 UTSW 1 135,899,825 (GRCm39) nonsense probably null
R9371:Igfn1 UTSW 1 135,906,001 (GRCm39) missense probably damaging 1.00
R9532:Igfn1 UTSW 1 135,897,229 (GRCm39) missense possibly damaging 0.61
R9653:Igfn1 UTSW 1 135,883,323 (GRCm39) nonsense probably null
R9666:Igfn1 UTSW 1 135,897,692 (GRCm39) missense possibly damaging 0.65
R9741:Igfn1 UTSW 1 135,895,383 (GRCm39) missense probably benign 0.00
R9748:Igfn1 UTSW 1 135,926,336 (GRCm39) missense possibly damaging 0.89
R9796:Igfn1 UTSW 1 135,897,611 (GRCm39) missense probably benign 0.26
Z1176:Igfn1 UTSW 1 135,899,738 (GRCm39) missense probably damaging 0.99
Z1177:Igfn1 UTSW 1 135,897,305 (GRCm39) missense probably benign 0.26
Z1177:Igfn1 UTSW 1 135,883,547 (GRCm39) missense probably damaging 1.00
Z1177:Igfn1 UTSW 1 135,910,164 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCTTAGAAGGCTGGATCCTTAGC -3'
(R):5'- GCCAGGATCAGCAGGTCAATAC -3'

Sequencing Primer
(F):5'- GGCTCAATGGAGGTAGACTGTC -3'
(R):5'- GGTCAATACCTGGACACTTCTGAC -3'
Posted On 2022-02-07