Mutagenetix > Incidental Mutation

Incidental Mutation 'R9205:Igfn1'

698415

Institutional Source

Beutler Lab

Gene Symbol

Igfn1

Ensembl Gene

ENSMUSG00000051985

Gene Name

immunoglobulin-like and fibronectin type III domain containing 1

Synonyms

9830123M21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R9205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135953578-136006342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135975957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 348 (V348I)

Ref Sequence

ENSEMBL: ENSMUSP00000129680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166193]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124134
AA Change: V227I

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: V227I

Domain	Start	End	E-Value	Type
IG	73	159	1.29e-6	SMART
IG_like	258	344	5.45e1	SMART
IG	354	435	1.79e0	SMART
IG	445	524	3.54e-4	SMART
IG	538	624	4.86e-2	SMART
FN3	627	711	3.99e-10	SMART
FN3	727	810	9.1e-14	SMART
FN3	828	911	1.5e-14	SMART
IG	938	1021	6.41e-2	SMART
FN3	1024	1106	3.2e-9	SMART
IGc2	1152	1219	4.89e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166193
AA Change: V348I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: V348I

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
IG	193	279	1.29e-6	SMART
PDB:2LHU\|A	302	365	8e-7	PDB
IG_like	378	464	5.45e1	SMART
IG	474	555	1.79e0	SMART
low complexity region	724	739	N/A	INTRINSIC
internal_repeat_2	838	1006	9.98e-5	PROSPERO
low complexity region	1067	1084	N/A	INTRINSIC
internal_repeat_2	1812	1967	9.98e-5	PROSPERO
Pfam:I-set	2054	2139	6.2e-8	PFAM
IG	2153	2239	4.86e-2	SMART
FN3	2242	2326	3.99e-10	SMART
FN3	2342	2425	9.1e-14	SMART
FN3	2443	2526	1.5e-14	SMART
IG	2553	2636	6.41e-2	SMART
FN3	2639	2721	3.2e-9	SMART
IGc2	2767	2834	4.89e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.3%

Validation Efficiency

95% (76/80)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	T	A	6: 140,642,228	H341Q	probably damaging	Het
Apob	G	A	12: 7,980,635	A125T	probably damaging	Het
Bace2	G	T	16: 97,356,859	A20S	unknown	Het
Bcar1	T	C	8: 111,715,709	Y238C	probably damaging	Het
Brinp3	A	T	1: 146,902,089	D758V	possibly damaging	Het
Btnl10	T	C	11: 58,920,519	S223P	probably damaging	Het
Cckar	C	T	5: 53,707,245		probably null	Het
Cdhr2	A	G	13: 54,713,988	N66S	probably benign	Het
Chd9	A	G	8: 91,030,642	M1890V	probably benign	Het
Col6a5	C	T	9: 105,878,638	G2196R	probably damaging	Het
Col9a1	T	G	1: 24,185,094	M119R	unknown	Het
Cryaa	A	G	17: 31,679,668	H123R	probably damaging	Het
Cux1	A	T	5: 136,370,135	D171E	probably damaging	Het
Dgkz	T	A	2: 91,933,799	T1067S	probably benign	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dnah5	T	C	15: 28,448,334	M4181T	possibly damaging	Het
Dnajb14	A	G	3: 137,908,384	E352G	possibly damaging	Het
Dnmt3l	T	A	10: 78,056,752		probably null	Het
Dph6	T	C	2: 114,569,514	I117V	probably damaging	Het
Dsg1a	A	G	18: 20,340,171	D767G	probably damaging	Het
Edn3	C	T	2: 174,761,689	P77S	possibly damaging	Het
Elmsan1	A	C	12: 84,152,887	F1020V	probably benign	Het
Fbln7	A	C	2: 128,895,248	S328R	probably null	Het
Fbn2	T	C	18: 58,059,356	R1518G	probably damaging	Het
Foxi2	A	T	7: 135,411,796	T252S	probably benign	Het
Foxred2	A	G	15: 77,952,006	S384P	probably damaging	Het
Gdpd1	G	A	11: 87,045,183	H174Y	probably benign	Het
Gm10542	A	C	18: 44,204,638	D61A	possibly damaging	Het
Gm10563	TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	4: 155,635,850		probably benign	Het
H2-Ab1	A	G	17: 34,265,007	E114G	probably damaging	Het
Htt	C	T	5: 34,819,023	T723M	probably benign	Het
Itpr1	T	A	6: 108,489,849	L2173Q	probably damaging	Het
Lamp5	A	G	2: 136,059,601	Y115C	probably damaging	Het
Lrp1	T	A	10: 127,594,981	K400*	probably null	Het
Man2a2	C	T	7: 80,361,120	V708I	probably benign	Het
Matr3	T	C	18: 35,587,721	S746P	probably benign	Het
Me1	C	T	9: 86,598,794	V353M	probably benign	Het
Nbeal1	T	A	1: 60,278,680	D1925E	probably damaging	Het
Oca2	T	A	7: 56,316,420	F387I	probably damaging	Het
Olfr1163	T	A	2: 88,070,434	H316L	probably benign	Het
Olfr181	T	G	16: 58,926,122	I150L	probably benign	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr212	T	A	6: 116,516,354	N192K	probably benign	Het
Olfr420	T	C	1: 174,158,890	I39T	probably benign	Het
Olfr912	T	A	9: 38,582,077	S267T	probably benign	Het
Opn3	G	T	1: 175,663,089	N335K	probably benign	Het
Osm	A	G	11: 4,238,504	N44D	possibly damaging	Het
Otop2	T	C	11: 115,329,086	Y251H	probably damaging	Het
Pappa	T	C	4: 65,156,375	S389P	possibly damaging	Het
Polr1d	C	T	5: 147,101,258	A19V	probably damaging	Het
Ptchd4	G	A	17: 42,503,385	V726M	probably benign	Het
Pzp	T	A	6: 128,496,663	D731V	probably benign	Het
Rgl2	A	T	17: 33,936,028	I669F	probably damaging	Het
Rpl38	T	C	11: 114,672,288	*71R	probably null	Het
Rufy1	G	A	11: 50,398,474	R514W	probably damaging	Het
Ruvbl2	G	A	7: 45,434,317		probably benign	Het
Scn9a	T	G	2: 66,533,313	I874L	probably damaging	Het
Slc14a2	A	G	18: 78,195,736	S85P	probably benign	Het
Slc17a1	A	G	13: 23,878,811	I287V	probably benign	Het
Slc35f3	T	A	8: 126,389,189	I285N	probably damaging	Het
Slx4	A	G	16: 3,988,063	S542P	possibly damaging	Het
Sox30	A	T	11: 46,017,353	L782F	probably damaging	Het
Sspo	A	G	6: 48,455,872	N894S	probably benign	Het
Syne1	G	A	10: 5,202,013	Q5765*	probably null	Het
Taar7e	T	C	10: 24,038,074	I154T	probably benign	Het
Tars	A	G	15: 11,397,179		probably null	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem198b	A	T	10: 128,803,188	C29S	probably damaging	Het
Tnr	A	C	1: 159,895,047	M1021L	probably benign	Het
Tom1l1	G	A	11: 90,657,818	P309L	probably damaging	Het
Traf4	A	G	11: 78,161,101	S186P	probably benign	Het
Trpm1	T	G	7: 64,240,571	V974G	possibly damaging	Het
Tsga10	T	A	1: 37,841,278		probably benign	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r93	A	T	17: 18,304,019	I92F	probably damaging	Het
Zfp457	A	T	13: 67,293,901	D203E	probably benign	Het
Zfp518b	G	A	5: 38,674,158	S168F	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp777	G	A	6: 48,025,587	T523M	probably benign	Het

Other mutations in Igfn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Igfn1	APN	1	135966726	missense	probably damaging	1.00
IGL02299:Igfn1	APN	1	135954017	utr 3 prime	probably benign
Bounty	UTSW	1	135976917	critical splice donor site	probably null
R2276_Igfn1_773	UTSW	1	135964741	missense	probably damaging	0.98
R4058_Igfn1_315	UTSW	1	135969756	missense	probably benign	0.07
R0144:Igfn1	UTSW	1	135962013	missense	probably damaging	0.99
R0190:Igfn1	UTSW	1	135962052	missense	probably damaging	1.00
R0350:Igfn1	UTSW	1	135956767	nonsense	probably null
R0413:Igfn1	UTSW	1	135967596	missense	probably benign	0.23
R0504:Igfn1	UTSW	1	135968529	missense	probably benign	0.00
R0606:Igfn1	UTSW	1	135959901	missense	probably damaging	1.00
R0681:Igfn1	UTSW	1	135963853	missense	possibly damaging	0.88
R0825:Igfn1	UTSW	1	135963126	missense	probably damaging	1.00
R0839:Igfn1	UTSW	1	135954680	missense	probably damaging	1.00
R1066:Igfn1	UTSW	1	135970725	missense	probably benign
R1078:Igfn1	UTSW	1	135974847	missense	probably damaging	1.00
R1224:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R1569:Igfn1	UTSW	1	135969033	missense	probably benign
R1626:Igfn1	UTSW	1	135968967	missense	probably benign	0.29
R1663:Igfn1	UTSW	1	135968308	missense	probably benign	0.15
R1677:Igfn1	UTSW	1	135971101	missense	probably damaging	0.99
R1709:Igfn1	UTSW	1	135955573	missense	probably benign	0.24
R1728:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1728:Igfn1	UTSW	1	135968199	missense	probably benign
R1728:Igfn1	UTSW	1	135970411	missense	probably benign
R1728:Igfn1	UTSW	1	135972127	missense	probably benign
R1728:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1728:Igfn1	UTSW	1	135982475	missense	probably benign
R1728:Igfn1	UTSW	1	135998625	missense	probably benign
R1728:Igfn1	UTSW	1	135998683	missense	unknown
R1729:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1729:Igfn1	UTSW	1	135968199	missense	probably benign
R1729:Igfn1	UTSW	1	135970411	missense	probably benign
R1729:Igfn1	UTSW	1	135972127	missense	probably benign
R1729:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1729:Igfn1	UTSW	1	135982475	missense	probably benign
R1729:Igfn1	UTSW	1	135998625	missense	probably benign
R1729:Igfn1	UTSW	1	135998683	missense	unknown
R1730:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1730:Igfn1	UTSW	1	135968199	missense	probably benign
R1730:Igfn1	UTSW	1	135970411	missense	probably benign
R1730:Igfn1	UTSW	1	135972127	missense	probably benign
R1730:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1730:Igfn1	UTSW	1	135982475	missense	probably benign
R1730:Igfn1	UTSW	1	135998625	missense	probably benign
R1730:Igfn1	UTSW	1	135998683	missense	unknown
R1739:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1739:Igfn1	UTSW	1	135968199	missense	probably benign
R1739:Igfn1	UTSW	1	135970411	missense	probably benign
R1739:Igfn1	UTSW	1	135972127	missense	probably benign
R1739:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1739:Igfn1	UTSW	1	135982475	missense	probably benign
R1739:Igfn1	UTSW	1	135998625	missense	probably benign
R1739:Igfn1	UTSW	1	135998683	missense	unknown
R1746:Igfn1	UTSW	1	135969823	missense	possibly damaging	0.88
R1762:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1762:Igfn1	UTSW	1	135968199	missense	probably benign
R1762:Igfn1	UTSW	1	135970411	missense	probably benign
R1762:Igfn1	UTSW	1	135972127	missense	probably benign
R1762:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1762:Igfn1	UTSW	1	135982475	missense	probably benign
R1762:Igfn1	UTSW	1	135998625	missense	probably benign
R1762:Igfn1	UTSW	1	135998683	missense	unknown
R1783:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1783:Igfn1	UTSW	1	135968199	missense	probably benign
R1783:Igfn1	UTSW	1	135970411	missense	probably benign
R1783:Igfn1	UTSW	1	135972127	missense	probably benign
R1783:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1783:Igfn1	UTSW	1	135982475	missense	probably benign
R1783:Igfn1	UTSW	1	135998625	missense	probably benign
R1783:Igfn1	UTSW	1	135998683	missense	unknown
R1784:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1784:Igfn1	UTSW	1	135968199	missense	probably benign
R1784:Igfn1	UTSW	1	135970411	missense	probably benign
R1784:Igfn1	UTSW	1	135972127	missense	probably benign
R1784:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1784:Igfn1	UTSW	1	135982475	missense	probably benign
R1784:Igfn1	UTSW	1	135998625	missense	probably benign
R1784:Igfn1	UTSW	1	135998683	missense	unknown
R1785:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1785:Igfn1	UTSW	1	135968199	missense	probably benign
R1785:Igfn1	UTSW	1	135970411	missense	probably benign
R1785:Igfn1	UTSW	1	135972127	missense	probably benign
R1785:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1785:Igfn1	UTSW	1	135982475	missense	probably benign
R1785:Igfn1	UTSW	1	135998625	missense	probably benign
R1785:Igfn1	UTSW	1	135998683	missense	unknown
R1847:Igfn1	UTSW	1	135969388	missense	probably benign
R1866:Igfn1	UTSW	1	135974868	splice site	probably null
R1921:Igfn1	UTSW	1	135966063	critical splice donor site	probably null
R1984:Igfn1	UTSW	1	135962044	missense	probably benign	0.39
R2049:Igfn1	UTSW	1	135970638	missense	probably benign
R2049:Igfn1	UTSW	1	135974852	splice site	probably benign
R2098:Igfn1	UTSW	1	135978305	missense	probably damaging	1.00
R2130:Igfn1	UTSW	1	135974852	splice site	probably benign
R2141:Igfn1	UTSW	1	135974852	splice site	probably benign
R2276:Igfn1	UTSW	1	135964741	missense	probably damaging	0.98
R2425:Igfn1	UTSW	1	135963102	missense	probably damaging	1.00
R2483:Igfn1	UTSW	1	135969537	missense	probably benign
R2504:Igfn1	UTSW	1	135969316	missense	probably benign	0.07
R3109:Igfn1	UTSW	1	135997848	missense	probably benign	0.12
R3421:Igfn1	UTSW	1	135976917	critical splice donor site	probably null
R3423:Igfn1	UTSW	1	135998641	missense	probably benign	0.01
R3705:Igfn1	UTSW	1	135968409	missense	probably benign
R3871:Igfn1	UTSW	1	135968836	missense	probably benign	0.03
R3875:Igfn1	UTSW	1	135954614	missense	probably damaging	1.00
R3953:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3955:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3957:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3965:Igfn1	UTSW	1	135967819	missense	probably benign
R4006:Igfn1	UTSW	1	135982362	splice site	probably null
R4058:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4059:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4370:Igfn1	UTSW	1	135968106	missense	probably benign	0.00
R4380:Igfn1	UTSW	1	135967771	missense	probably benign	0.00
R4495:Igfn1	UTSW	1	135969678	missense	possibly damaging	0.79
R4628:Igfn1	UTSW	1	135959730	missense	possibly damaging	0.47
R4672:Igfn1	UTSW	1	135965369	missense	possibly damaging	0.72
R4682:Igfn1	UTSW	1	135998625	missense	probably benign
R4702:Igfn1	UTSW	1	135967209	missense	possibly damaging	0.71
R4744:Igfn1	UTSW	1	135982458	missense	probably benign	0.07
R4777:Igfn1	UTSW	1	135954862	missense	probably benign
R4806:Igfn1	UTSW	1	135967357	missense	probably benign	0.01
R4840:Igfn1	UTSW	1	135968040	missense	probably benign	0.00
R4894:Igfn1	UTSW	1	135954782	missense	probably damaging	1.00
R4998:Igfn1	UTSW	1	135954666	missense	probably damaging	1.00
R5092:Igfn1	UTSW	1	135964826	missense	probably benign
R5108:Igfn1	UTSW	1	135982441	missense	probably benign
R5120:Igfn1	UTSW	1	135973502	missense	possibly damaging	0.93
R5127:Igfn1	UTSW	1	135959896	missense	probably damaging	1.00
R5231:Igfn1	UTSW	1	135966736	missense	probably benign	0.26
R5286:Igfn1	UTSW	1	135967861	missense	probably benign	0.10
R5307:Igfn1	UTSW	1	135964938	missense	probably damaging	1.00
R5380:Igfn1	UTSW	1	135966087	missense	probably damaging	1.00
R5553:Igfn1	UTSW	1	135967884	missense	probably damaging	1.00
R5660:Igfn1	UTSW	1	135970414	missense	probably benign	0.01
R5779:Igfn1	UTSW	1	135966840	missense	probably benign	0.16
R5818:Igfn1	UTSW	1	135966126	missense	possibly damaging	0.72
R5832:Igfn1	UTSW	1	135974795	missense	probably damaging	0.96
R5933:Igfn1	UTSW	1	135970603	nonsense	probably null
R5966:Igfn1	UTSW	1	135965414	missense	probably damaging	1.00
R6116:Igfn1	UTSW	1	135970467	missense	probably benign	0.00
R6297:Igfn1	UTSW	1	135964661	critical splice donor site	probably null
R6652:Igfn1	UTSW	1	135963871	missense	probably damaging	1.00
R6737:Igfn1	UTSW	1	135969867	missense	probably benign
R6816:Igfn1	UTSW	1	135959728	missense	probably benign	0.02
R6886:Igfn1	UTSW	1	135973460	missense	probably damaging	1.00
R6888:Igfn1	UTSW	1	135982480	missense	probably benign	0.33
R6975:Igfn1	UTSW	1	135968445	missense	probably damaging	0.96
R7105:Igfn1	UTSW	1	135984218	missense	probably benign	0.11
R7114:Igfn1	UTSW	1	135966781	missense	probably benign	0.01
R7233:Igfn1	UTSW	1	135970135	missense	probably benign	0.41
R7276:Igfn1	UTSW	1	135998638	missense	possibly damaging	0.85
R7354:Igfn1	UTSW	1	135976032	missense	possibly damaging	0.72
R7358:Igfn1	UTSW	1	135964000	missense	probably damaging	1.00
R7380:Igfn1	UTSW	1	135962008	missense	probably damaging	1.00
R7389:Igfn1	UTSW	1	135967047	missense	probably benign	0.00
R7513:Igfn1	UTSW	1	135959967	missense	probably damaging	1.00
R7718:Igfn1	UTSW	1	135969036	missense	probably benign
R7769:Igfn1	UTSW	1	135982405	missense	possibly damaging	0.85
R7810:Igfn1	UTSW	1	135974789	missense	probably damaging	0.98
R7917:Igfn1	UTSW	1	135971968	missense	probably damaging	0.99
R7952:Igfn1	UTSW	1	135963955	missense	probably damaging	0.99
R8041:Igfn1	UTSW	1	135968059	nonsense	probably null
R8233:Igfn1	UTSW	1	135968044	missense	probably benign	0.00
R8354:Igfn1	UTSW	1	135959881	missense	possibly damaging	0.61
R8363:Igfn1	UTSW	1	135963887	missense	probably benign	0.01
R8428:Igfn1	UTSW	1	135967782	missense	probably damaging	1.00
R8731:Igfn1	UTSW	1	135997836	missense	probably benign	0.02
R8756:Igfn1	UTSW	1	135967960	missense	probably benign	0.10
R8797:Igfn1	UTSW	1	135974835	missense	possibly damaging	0.93
R8913:Igfn1	UTSW	1	135963841	missense	possibly damaging	0.90
R8927:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R8928:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R9087:Igfn1	UTSW	1	135974868	splice site	probably null
R9109:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9113:Igfn1	UTSW	1	135955590	missense	probably damaging	1.00
R9117:Igfn1	UTSW	1	135974790	missense	probably benign	0.03
R9251:Igfn1	UTSW	1	135966671	splice site	probably benign
R9260:Igfn1	UTSW	1	135979956	missense	probably benign	0.45
R9275:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9277:Igfn1	UTSW	1	135959782	missense	probably damaging	0.98
R9278:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9287:Igfn1	UTSW	1	135997806	missense	probably benign	0.33
R9298:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9356:Igfn1	UTSW	1	135972087	nonsense	probably null
R9371:Igfn1	UTSW	1	135978263	missense	probably damaging	1.00
R9532:Igfn1	UTSW	1	135969491	missense	possibly damaging	0.61
R9653:Igfn1	UTSW	1	135955585	nonsense	probably null
R9666:Igfn1	UTSW	1	135969954	missense	possibly damaging	0.65
R9741:Igfn1	UTSW	1	135967645	missense	probably benign	0.00
R9748:Igfn1	UTSW	1	135998598	missense	possibly damaging	0.89
R9796:Igfn1	UTSW	1	135969873	missense	probably benign	0.26
Z1176:Igfn1	UTSW	1	135972000	missense	probably damaging	0.99
Z1177:Igfn1	UTSW	1	135955809	missense	probably damaging	1.00
Z1177:Igfn1	UTSW	1	135969567	missense	probably benign	0.26
Z1177:Igfn1	UTSW	1	135982426	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GCTTAGAAGGCTGGATCCTTAGC -3'
(R):5'- GCCAGGATCAGCAGGTCAATAC -3'

Sequencing Primer
(F):5'- GGCTCAATGGAGGTAGACTGTC -3'
(R):5'- GGTCAATACCTGGACACTTCTGAC -3'

Posted On

2022-02-07