Incidental Mutation 'R9205:Pappa'
ID 698428
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Name pregnancy-associated plasma protein A
Synonyms PAPP-A, PAG1, 8430414N03Rik, IGFBP-4ase
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 65042411-65275746 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65074612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 389 (S389P)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
AlphaFold Q8R4K8
Predicted Effect possibly damaging
Transcript: ENSMUST00000084501
AA Change: S389P

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: S389P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65,107,553 (GRCm39) missense probably damaging 1.00
IGL01340:Pappa APN 4 65,242,109 (GRCm39) missense possibly damaging 0.49
IGL01482:Pappa APN 4 65,074,271 (GRCm39) missense probably benign 0.18
IGL01485:Pappa APN 4 65,107,536 (GRCm39) missense probably damaging 0.96
IGL01759:Pappa APN 4 65,123,395 (GRCm39) splice site probably null
IGL01860:Pappa APN 4 65,123,329 (GRCm39) missense possibly damaging 0.50
IGL01990:Pappa APN 4 65,074,924 (GRCm39) splice site probably benign
IGL02089:Pappa APN 4 65,074,361 (GRCm39) missense possibly damaging 0.75
IGL02153:Pappa APN 4 65,215,674 (GRCm39) missense probably damaging 0.96
IGL02184:Pappa APN 4 65,258,928 (GRCm39) missense possibly damaging 0.82
IGL02324:Pappa APN 4 65,115,045 (GRCm39) missense probably damaging 0.99
IGL02542:Pappa APN 4 65,094,518 (GRCm39) missense probably damaging 1.00
IGL02556:Pappa APN 4 65,074,863 (GRCm39) missense possibly damaging 0.56
IGL02698:Pappa APN 4 65,099,257 (GRCm39) missense probably damaging 1.00
IGL02903:Pappa APN 4 65,180,217 (GRCm39) missense probably damaging 1.00
IGL02974:Pappa APN 4 65,123,172 (GRCm39) missense probably damaging 1.00
IGL03107:Pappa APN 4 65,122,940 (GRCm39) missense probably damaging 1.00
IGL03376:Pappa APN 4 65,115,071 (GRCm39) missense probably benign 0.01
caer UTSW 4 65,043,128 (GRCm39) missense probably damaging 0.98
Maennel UTSW 4 65,232,824 (GRCm39) missense probably benign 0.05
maennelein UTSW 4 65,233,033 (GRCm39) splice site probably null
mama UTSW 4 65,123,104 (GRCm39) missense possibly damaging 0.94
Revisitation UTSW 4 65,212,705 (GRCm39) missense probably damaging 0.96
Sesquester UTSW 4 65,074,612 (GRCm39) missense possibly damaging 0.66
untersuchen UTSW 4 65,215,494 (GRCm39) missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65,226,011 (GRCm39) missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65,234,469 (GRCm39) missense probably damaging 1.00
R0077:Pappa UTSW 4 65,226,049 (GRCm39) missense probably damaging 1.00
R0390:Pappa UTSW 4 65,269,850 (GRCm39) splice site probably null
R0458:Pappa UTSW 4 65,074,119 (GRCm39) missense probably damaging 1.00
R0883:Pappa UTSW 4 65,107,552 (GRCm39) nonsense probably null
R0946:Pappa UTSW 4 65,233,029 (GRCm39) critical splice donor site probably null
R1228:Pappa UTSW 4 65,258,926 (GRCm39) missense probably damaging 1.00
R1327:Pappa UTSW 4 65,269,840 (GRCm39) splice site probably benign
R1489:Pappa UTSW 4 65,099,185 (GRCm39) missense possibly damaging 0.85
R1619:Pappa UTSW 4 65,094,466 (GRCm39) missense probably damaging 1.00
R1856:Pappa UTSW 4 65,258,980 (GRCm39) missense probably damaging 1.00
R2047:Pappa UTSW 4 65,149,378 (GRCm39) splice site probably benign
R2102:Pappa UTSW 4 65,234,465 (GRCm39) nonsense probably null
R2127:Pappa UTSW 4 65,215,494 (GRCm39) missense probably damaging 1.00
R2143:Pappa UTSW 4 65,099,186 (GRCm39) nonsense probably null
R2144:Pappa UTSW 4 65,099,186 (GRCm39) nonsense probably null
R2166:Pappa UTSW 4 65,074,682 (GRCm39) missense probably damaging 1.00
R2167:Pappa UTSW 4 65,074,682 (GRCm39) missense probably damaging 1.00
R2168:Pappa UTSW 4 65,074,682 (GRCm39) missense probably damaging 1.00
R2178:Pappa UTSW 4 65,269,924 (GRCm39) missense probably benign 0.00
R2504:Pappa UTSW 4 65,099,126 (GRCm39) nonsense probably null
R4043:Pappa UTSW 4 65,232,824 (GRCm39) missense probably benign 0.05
R4289:Pappa UTSW 4 65,074,100 (GRCm39) missense probably benign 0.19
R4415:Pappa UTSW 4 65,223,532 (GRCm39) missense probably benign 0.00
R4529:Pappa UTSW 4 65,149,419 (GRCm39) missense probably benign
R4620:Pappa UTSW 4 65,245,265 (GRCm39) missense probably benign 0.43
R4657:Pappa UTSW 4 65,233,033 (GRCm39) splice site probably null
R4658:Pappa UTSW 4 65,233,033 (GRCm39) splice site probably null
R5074:Pappa UTSW 4 65,123,365 (GRCm39) missense probably benign 0.15
R5200:Pappa UTSW 4 65,074,076 (GRCm39) missense probably damaging 1.00
R5420:Pappa UTSW 4 65,254,017 (GRCm39) critical splice donor site probably null
R5469:Pappa UTSW 4 65,123,389 (GRCm39) missense probably benign 0.01
R5651:Pappa UTSW 4 65,074,589 (GRCm39) missense probably damaging 0.99
R5725:Pappa UTSW 4 65,107,647 (GRCm39) missense probably damaging 1.00
R5941:Pappa UTSW 4 65,232,830 (GRCm39) missense possibly damaging 0.52
R6002:Pappa UTSW 4 65,215,645 (GRCm39) missense probably damaging 0.99
R6252:Pappa UTSW 4 65,107,649 (GRCm39) missense probably benign 0.02
R6303:Pappa UTSW 4 65,122,891 (GRCm39) missense probably damaging 1.00
R6322:Pappa UTSW 4 65,232,896 (GRCm39) missense probably damaging 1.00
R6431:Pappa UTSW 4 65,074,701 (GRCm39) missense probably damaging 1.00
R6462:Pappa UTSW 4 65,043,128 (GRCm39) missense probably damaging 0.98
R6484:Pappa UTSW 4 65,232,896 (GRCm39) missense probably damaging 1.00
R6537:Pappa UTSW 4 65,215,519 (GRCm39) missense probably damaging 0.99
R6578:Pappa UTSW 4 65,074,374 (GRCm39) missense possibly damaging 0.48
R6704:Pappa UTSW 4 65,123,161 (GRCm39) missense probably damaging 1.00
R6789:Pappa UTSW 4 65,099,278 (GRCm39) missense probably damaging 1.00
R7023:Pappa UTSW 4 65,269,955 (GRCm39) missense probably benign 0.00
R7139:Pappa UTSW 4 65,107,687 (GRCm39) missense probably benign 0.30
R7158:Pappa UTSW 4 65,123,104 (GRCm39) missense possibly damaging 0.94
R7165:Pappa UTSW 4 65,180,110 (GRCm39) missense probably damaging 1.00
R7196:Pappa UTSW 4 65,242,128 (GRCm39) splice site probably null
R7410:Pappa UTSW 4 65,253,956 (GRCm39) missense probably damaging 1.00
R7457:Pappa UTSW 4 65,107,503 (GRCm39) missense probably damaging 1.00
R7506:Pappa UTSW 4 65,149,419 (GRCm39) missense probably benign 0.00
R7546:Pappa UTSW 4 65,074,352 (GRCm39) missense possibly damaging 0.48
R7975:Pappa UTSW 4 65,212,705 (GRCm39) missense probably damaging 0.96
R8111:Pappa UTSW 4 65,180,229 (GRCm39) missense probably damaging 0.99
R8260:Pappa UTSW 4 65,234,419 (GRCm39) missense probably damaging 0.99
R8347:Pappa UTSW 4 65,245,302 (GRCm39) missense probably damaging 1.00
R8520:Pappa UTSW 4 65,254,001 (GRCm39) missense probably benign 0.01
R8812:Pappa UTSW 4 65,123,166 (GRCm39) missense possibly damaging 0.94
R8815:Pappa UTSW 4 65,099,347 (GRCm39) missense probably benign 0.00
R9008:Pappa UTSW 4 65,074,426 (GRCm39) missense probably damaging 1.00
R9162:Pappa UTSW 4 65,123,040 (GRCm39) missense probably damaging 1.00
R9170:Pappa UTSW 4 65,258,962 (GRCm39) missense probably damaging 1.00
R9336:Pappa UTSW 4 65,042,918 (GRCm39) missense unknown
R9389:Pappa UTSW 4 65,099,125 (GRCm39) missense probably damaging 1.00
R9781:Pappa UTSW 4 65,043,104 (GRCm39) missense possibly damaging 0.89
RF006:Pappa UTSW 4 65,242,110 (GRCm39) missense probably benign 0.00
RF020:Pappa UTSW 4 65,123,282 (GRCm39) missense possibly damaging 0.77
X0058:Pappa UTSW 4 65,074,469 (GRCm39) missense probably damaging 1.00
X0060:Pappa UTSW 4 65,043,178 (GRCm39) missense probably benign 0.00
Z1177:Pappa UTSW 4 65,225,995 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACTAATTTGGAGCCCC -3'
(R):5'- CTGCTTCTTCATGAACGCAG -3'

Sequencing Primer
(F):5'- CCTCTTTGTGGGCAGACACTG -3'
(R):5'- CTTCTTCATGAACGCAGGGTAGC -3'
Posted On 2022-02-07