Incidental Mutation 'R9205:Htt'
ID 698430
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Name huntingtin
Synonyms Hdh, huntingtin, HD, IT15, htt, C430023I11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 34919084-35069878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34976367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 723 (T723M)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080036
AA Change: T723M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: T723M

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148953
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34,956,752 (GRCm39) missense probably benign 0.00
IGL00233:Htt APN 5 35,053,370 (GRCm39) splice site probably null
IGL00559:Htt APN 5 35,006,448 (GRCm39) splice site probably benign
IGL00765:Htt APN 5 35,034,769 (GRCm39) splice site probably benign
IGL00950:Htt APN 5 35,048,785 (GRCm39) missense probably benign
IGL00953:Htt APN 5 34,976,021 (GRCm39) missense probably benign 0.04
IGL00957:Htt APN 5 34,964,068 (GRCm39) missense probably benign
IGL01314:Htt APN 5 35,036,200 (GRCm39) missense probably benign
IGL01412:Htt APN 5 35,055,916 (GRCm39) missense probably damaging 0.98
IGL01510:Htt APN 5 35,064,856 (GRCm39) missense probably damaging 1.00
IGL01617:Htt APN 5 35,034,099 (GRCm39) missense possibly damaging 0.67
IGL01893:Htt APN 5 35,034,174 (GRCm39) missense probably damaging 1.00
IGL01914:Htt APN 5 34,987,053 (GRCm39) missense probably benign
IGL01994:Htt APN 5 34,989,948 (GRCm39) missense possibly damaging 0.83
IGL02102:Htt APN 5 35,048,825 (GRCm39) splice site probably benign
IGL02381:Htt APN 5 34,987,104 (GRCm39) missense probably benign 0.03
IGL02529:Htt APN 5 34,976,387 (GRCm39) splice site probably benign
IGL02678:Htt APN 5 35,057,246 (GRCm39) missense probably damaging 1.00
IGL02707:Htt APN 5 34,987,225 (GRCm39) critical splice donor site probably null
IGL02731:Htt APN 5 34,961,137 (GRCm39) missense probably benign 0.41
IGL02931:Htt APN 5 35,034,097 (GRCm39) missense probably damaging 1.00
IGL03167:Htt APN 5 34,976,330 (GRCm39) missense probably damaging 0.98
IGL03343:Htt APN 5 34,983,385 (GRCm39) missense probably benign
IGL03344:Htt APN 5 35,037,172 (GRCm39) missense probably benign 0.39
IGL03344:Htt APN 5 35,064,810 (GRCm39) missense probably benign 0.02
IGL03366:Htt APN 5 35,064,924 (GRCm39) missense probably damaging 1.00
IGL03410:Htt APN 5 34,956,789 (GRCm39) missense probably damaging 0.99
Chalk UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
IGL02796:Htt UTSW 5 35,034,826 (GRCm39) missense probably benign 0.43
PIT4377001:Htt UTSW 5 35,033,309 (GRCm39) missense probably benign 0.10
R0013:Htt UTSW 5 34,977,448 (GRCm39) missense probably benign 0.25
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0056:Htt UTSW 5 34,983,422 (GRCm39) splice site probably benign
R0207:Htt UTSW 5 35,054,252 (GRCm39) missense probably benign 0.11
R0329:Htt UTSW 5 34,974,478 (GRCm39) splice site probably benign
R0494:Htt UTSW 5 34,979,188 (GRCm39) missense possibly damaging 0.73
R0548:Htt UTSW 5 35,028,090 (GRCm39) missense probably damaging 1.00
R0601:Htt UTSW 5 35,003,347 (GRCm39) missense probably benign 0.08
R0799:Htt UTSW 5 34,975,097 (GRCm39) missense probably benign 0.00
R0947:Htt UTSW 5 35,056,268 (GRCm39) missense probably damaging 1.00
R1053:Htt UTSW 5 35,008,561 (GRCm39) critical splice acceptor site probably null
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1478:Htt UTSW 5 34,961,171 (GRCm39) missense probably damaging 0.99
R1573:Htt UTSW 5 35,021,718 (GRCm39) splice site probably benign
R1677:Htt UTSW 5 34,985,918 (GRCm39) missense probably damaging 1.00
R1792:Htt UTSW 5 35,064,543 (GRCm39) missense probably damaging 1.00
R1816:Htt UTSW 5 34,961,084 (GRCm39) missense probably benign 0.01
R1833:Htt UTSW 5 35,063,092 (GRCm39) splice site probably benign
R1837:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R1846:Htt UTSW 5 35,006,288 (GRCm39) missense probably damaging 0.98
R1875:Htt UTSW 5 34,951,456 (GRCm39) missense probably benign 0.05
R1899:Htt UTSW 5 35,064,429 (GRCm39) missense probably benign 0.01
R2013:Htt UTSW 5 35,010,215 (GRCm39) missense probably damaging 0.99
R2062:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2064:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2067:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2068:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2131:Htt UTSW 5 35,034,453 (GRCm39) missense possibly damaging 0.50
R2162:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R2169:Htt UTSW 5 35,034,819 (GRCm39) missense probably benign 0.08
R2345:Htt UTSW 5 34,983,348 (GRCm39) missense possibly damaging 0.80
R2433:Htt UTSW 5 35,064,885 (GRCm39) missense possibly damaging 0.65
R3027:Htt UTSW 5 34,977,439 (GRCm39) missense possibly damaging 0.85
R3123:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3125:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3717:Htt UTSW 5 34,968,866 (GRCm39) splice site probably benign
R3758:Htt UTSW 5 35,053,314 (GRCm39) missense probably damaging 0.97
R3805:Htt UTSW 5 35,034,548 (GRCm39) splice site probably null
R3833:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R4066:Htt UTSW 5 35,036,191 (GRCm39) missense probably benign
R4272:Htt UTSW 5 35,006,413 (GRCm39) missense possibly damaging 0.96
R4625:Htt UTSW 5 34,987,129 (GRCm39) missense probably damaging 0.99
R4634:Htt UTSW 5 35,033,292 (GRCm39) missense probably benign 0.06
R4655:Htt UTSW 5 35,063,476 (GRCm39) missense probably benign 0.06
R4679:Htt UTSW 5 34,977,424 (GRCm39) missense probably benign
R4684:Htt UTSW 5 35,010,109 (GRCm39) missense probably damaging 1.00
R4832:Htt UTSW 5 34,982,184 (GRCm39) missense probably benign 0.01
R4833:Htt UTSW 5 35,009,569 (GRCm39) missense probably damaging 0.98
R4973:Htt UTSW 5 34,970,367 (GRCm39) missense probably damaging 0.99
R5095:Htt UTSW 5 34,981,739 (GRCm39) missense possibly damaging 0.89
R5132:Htt UTSW 5 35,063,023 (GRCm39) missense possibly damaging 0.89
R5351:Htt UTSW 5 34,961,177 (GRCm39) missense probably damaging 0.99
R5361:Htt UTSW 5 35,064,928 (GRCm39) missense possibly damaging 0.47
R5399:Htt UTSW 5 35,034,495 (GRCm39) missense probably damaging 0.98
R5462:Htt UTSW 5 35,042,851 (GRCm39) nonsense probably null
R5552:Htt UTSW 5 34,979,118 (GRCm39) missense probably benign
R5566:Htt UTSW 5 35,006,419 (GRCm39) missense probably damaging 1.00
R5595:Htt UTSW 5 35,062,741 (GRCm39) missense probably damaging 0.96
R5617:Htt UTSW 5 35,028,150 (GRCm39) missense possibly damaging 0.77
R5835:Htt UTSW 5 34,970,534 (GRCm39) missense probably benign 0.16
R5891:Htt UTSW 5 35,028,167 (GRCm39) missense possibly damaging 0.62
R6158:Htt UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
R6159:Htt UTSW 5 34,962,020 (GRCm39) missense probably benign 0.08
R6169:Htt UTSW 5 35,064,817 (GRCm39) missense probably damaging 1.00
R6242:Htt UTSW 5 35,003,356 (GRCm39) missense probably damaging 1.00
R6274:Htt UTSW 5 35,009,431 (GRCm39) missense possibly damaging 0.81
R6280:Htt UTSW 5 35,028,103 (GRCm39) missense probably benign 0.00
R6294:Htt UTSW 5 34,979,170 (GRCm39) missense probably benign
R6331:Htt UTSW 5 35,053,231 (GRCm39) missense possibly damaging 0.89
R6448:Htt UTSW 5 35,033,336 (GRCm39) missense probably benign 0.05
R6474:Htt UTSW 5 34,982,239 (GRCm39) missense probably benign 0.06
R6592:Htt UTSW 5 35,034,388 (GRCm39) missense possibly damaging 0.92
R6818:Htt UTSW 5 34,940,111 (GRCm39) missense probably damaging 0.99
R6830:Htt UTSW 5 34,991,670 (GRCm39) missense possibly damaging 0.82
R6920:Htt UTSW 5 35,034,444 (GRCm39) missense probably null 1.00
R6962:Htt UTSW 5 35,057,115 (GRCm39) critical splice acceptor site probably null
R7057:Htt UTSW 5 34,979,067 (GRCm39) missense probably null 0.05
R7144:Htt UTSW 5 35,003,350 (GRCm39) missense probably damaging 1.00
R7166:Htt UTSW 5 35,010,238 (GRCm39) missense probably benign 0.42
R7329:Htt UTSW 5 34,987,099 (GRCm39) missense probably benign 0.03
R7378:Htt UTSW 5 34,961,143 (GRCm39) missense probably benign 0.04
R7418:Htt UTSW 5 34,947,697 (GRCm39) missense possibly damaging 0.55
R7495:Htt UTSW 5 34,968,821 (GRCm39) missense probably benign 0.00
R7554:Htt UTSW 5 35,022,084 (GRCm39) missense probably damaging 0.97
R7575:Htt UTSW 5 35,062,987 (GRCm39) missense probably damaging 1.00
R7763:Htt UTSW 5 35,009,534 (GRCm39) missense probably damaging 1.00
R7782:Htt UTSW 5 35,040,336 (GRCm39) missense probably benign 0.03
R7850:Htt UTSW 5 35,009,631 (GRCm39) splice site probably null
R7870:Htt UTSW 5 35,055,891 (GRCm39) missense possibly damaging 0.77
R7871:Htt UTSW 5 35,021,993 (GRCm39) missense probably benign 0.00
R7879:Htt UTSW 5 34,981,252 (GRCm39) missense probably benign
R7992:Htt UTSW 5 34,987,225 (GRCm39) critical splice donor site probably null
R8058:Htt UTSW 5 34,977,444 (GRCm39) missense probably benign
R8168:Htt UTSW 5 35,040,300 (GRCm39) missense probably benign 0.00
R8188:Htt UTSW 5 34,919,287 (GRCm39) missense probably benign 0.03
R8262:Htt UTSW 5 35,053,304 (GRCm39) missense probably benign
R8343:Htt UTSW 5 35,063,068 (GRCm39) missense probably damaging 1.00
R8353:Htt UTSW 5 35,034,499 (GRCm39) missense possibly damaging 0.49
R8769:Htt UTSW 5 34,977,633 (GRCm39) missense probably benign 0.05
R8808:Htt UTSW 5 35,046,791 (GRCm39) missense probably benign 0.10
R8825:Htt UTSW 5 34,983,304 (GRCm39) missense probably benign 0.24
R8843:Htt UTSW 5 35,046,809 (GRCm39) missense possibly damaging 0.92
R8856:Htt UTSW 5 35,060,675 (GRCm39) missense probably benign 0.44
R8882:Htt UTSW 5 34,979,061 (GRCm39) missense probably benign
R8898:Htt UTSW 5 34,976,376 (GRCm39) missense probably benign 0.01
R8964:Htt UTSW 5 35,062,720 (GRCm39) missense probably benign 0.09
R8987:Htt UTSW 5 34,977,368 (GRCm39) missense probably benign 0.18
R8991:Htt UTSW 5 35,063,062 (GRCm39) missense probably damaging 1.00
R9005:Htt UTSW 5 34,975,095 (GRCm39) missense possibly damaging 0.92
R9019:Htt UTSW 5 35,023,920 (GRCm39) missense probably damaging 1.00
R9057:Htt UTSW 5 35,009,454 (GRCm39) missense possibly damaging 0.86
R9157:Htt UTSW 5 34,987,171 (GRCm39) missense probably null 0.89
R9223:Htt UTSW 5 35,062,692 (GRCm39) missense probably benign 0.01
R9243:Htt UTSW 5 35,056,276 (GRCm39) splice site probably benign
R9329:Htt UTSW 5 34,989,957 (GRCm39) missense possibly damaging 0.69
R9355:Htt UTSW 5 35,053,247 (GRCm39) missense probably benign
R9402:Htt UTSW 5 35,006,324 (GRCm39) missense probably damaging 1.00
R9446:Htt UTSW 5 34,919,272 (GRCm39) missense probably benign
R9716:Htt UTSW 5 35,012,019 (GRCm39) missense probably damaging 1.00
Z1177:Htt UTSW 5 35,009,575 (GRCm39) missense probably null 0.87
Predicted Primers PCR Primer
(F):5'- GGGACACTTACAGGTTCAGG -3'
(R):5'- CTACACATAGGGGAGTCATGGG -3'

Sequencing Primer
(F):5'- CACTTACAGGTTCAGGAGTCAG -3'
(R):5'- TCATGGGACTAAGAACATGACC -3'
Posted On 2022-02-07