Incidental Mutation 'R9205:Tyw1'
ID 698433
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene Name tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms Rsafd1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 130284460-130370404 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 130298065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 202 (R202Q)
Ref Sequence ENSEMBL: ENSMUSP00000037173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]
AlphaFold Q8BJM7
Predicted Effect probably damaging
Transcript: ENSMUST00000040213
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044204
AA Change: R202Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100662
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147619
AA Change: R179Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: R179Q

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Meta Mutation Damage Score 0.3244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130,295,921 (GRCm39) missense probably benign 0.20
IGL02873:Tyw1 APN 5 130,364,171 (GRCm39) missense probably benign 0.00
IGL02879:Tyw1 APN 5 130,325,612 (GRCm39) missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130,295,896 (GRCm39) missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130,328,834 (GRCm39) missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130,369,575 (GRCm39) missense probably damaging 1.00
remnant UTSW 5 130,291,762 (GRCm39) missense probably damaging 0.99
schimmel UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
tyrone UTSW 5 130,325,520 (GRCm39) nonsense probably null
yang UTSW 5 130,287,876 (GRCm39) missense probably damaging 0.98
R1420:Tyw1 UTSW 5 130,303,586 (GRCm39) critical splice donor site probably null
R1650:Tyw1 UTSW 5 130,317,752 (GRCm39) missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130,298,169 (GRCm39) missense probably benign 0.01
R1789:Tyw1 UTSW 5 130,287,834 (GRCm39) missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130,291,652 (GRCm39) splice site probably benign
R2421:Tyw1 UTSW 5 130,298,101 (GRCm39) missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130,287,876 (GRCm39) missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130,364,073 (GRCm39) splice site probably null
R4835:Tyw1 UTSW 5 130,305,899 (GRCm39) missense probably benign
R5058:Tyw1 UTSW 5 130,305,927 (GRCm39) missense probably benign 0.03
R5190:Tyw1 UTSW 5 130,296,756 (GRCm39) nonsense probably null
R5398:Tyw1 UTSW 5 130,305,998 (GRCm39) intron probably benign
R5459:Tyw1 UTSW 5 130,303,547 (GRCm39) missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130,303,498 (GRCm39) missense probably benign 0.00
R5704:Tyw1 UTSW 5 130,310,863 (GRCm39) nonsense probably null
R5825:Tyw1 UTSW 5 130,296,929 (GRCm39) missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130,354,540 (GRCm39) missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130,296,752 (GRCm39) missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130,305,872 (GRCm39) missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130,310,792 (GRCm39) unclassified probably benign
R7012:Tyw1 UTSW 5 130,306,571 (GRCm39) splice site probably null
R7259:Tyw1 UTSW 5 130,296,713 (GRCm39) splice site probably null
R7328:Tyw1 UTSW 5 130,291,685 (GRCm39) missense probably benign 0.08
R7555:Tyw1 UTSW 5 130,303,547 (GRCm39) missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130,296,913 (GRCm39) missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130,328,855 (GRCm39) missense probably benign 0.19
R8196:Tyw1 UTSW 5 130,328,862 (GRCm39) missense probably damaging 1.00
R8714:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8970:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8992:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9117:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9119:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9120:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9172:Tyw1 UTSW 5 130,325,520 (GRCm39) nonsense probably null
R9204:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9207:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9325:Tyw1 UTSW 5 130,291,762 (GRCm39) missense probably damaging 0.99
R9364:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9368:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9369:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9470:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9471:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9566:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9567:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGAAGCCTGCTTTAGAG -3'
(R):5'- ATCCCCAGGATGCAATTCG -3'

Sequencing Primer
(F):5'- GCCTGCTTTAGAGGACAGATG -3'
(R):5'- CAGGATGCAATTCGCCTTG -3'
Posted On 2022-02-07