Incidental Mutation 'R9205:Cux1'
ID 698434
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms CDP, Cutl1, Cux, Cux-1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # R9205 (G1)
Quality Score 177.009
Status Validated
Chromosome 5
Chromosomal Location 136276989-136596344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 136398989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 171 (D171E)
Ref Sequence ENSEMBL: ENSMUSP00000135086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000004097
AA Change: D182E

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: D182E

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175918
AA Change: D145E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705
AA Change: D145E

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175975
AA Change: D182E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: D182E

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: D171E

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
AA Change: D182E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: D182E

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: D44E

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176745
AA Change: D182E

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: D182E

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: D267E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: D267E

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
AA Change: D182E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: D182E

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Trpm1 T G 7: 63,890,319 (GRCm39) V974G possibly damaging Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136,355,650 (GRCm39) missense probably damaging 1.00
IGL00966:Cux1 APN 5 136,340,345 (GRCm39) intron probably benign
IGL01129:Cux1 APN 5 136,333,572 (GRCm39) intron probably benign
IGL01885:Cux1 APN 5 136,337,301 (GRCm39) missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136,303,979 (GRCm39) missense probably benign 0.04
IGL02259:Cux1 APN 5 136,355,687 (GRCm39) missense probably damaging 1.00
IGL02666:Cux1 APN 5 136,304,169 (GRCm39) nonsense probably null
IGL02826:Cux1 APN 5 136,336,857 (GRCm39) missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136,594,379 (GRCm39) intron probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0057:Cux1 UTSW 5 136,285,136 (GRCm39) missense probably damaging 1.00
R0149:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0295:Cux1 UTSW 5 136,342,066 (GRCm39) missense probably benign 0.04
R0361:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0533:Cux1 UTSW 5 136,336,713 (GRCm39) missense probably damaging 1.00
R0630:Cux1 UTSW 5 136,315,689 (GRCm39) missense probably damaging 1.00
R0801:Cux1 UTSW 5 136,355,783 (GRCm39) missense probably damaging 0.97
R0884:Cux1 UTSW 5 136,336,689 (GRCm39) missense probably damaging 1.00
R0976:Cux1 UTSW 5 136,342,144 (GRCm39) missense probably damaging 1.00
R1073:Cux1 UTSW 5 136,281,395 (GRCm39) critical splice donor site probably null
R1222:Cux1 UTSW 5 136,304,003 (GRCm39) missense probably benign 0.18
R1518:Cux1 UTSW 5 136,337,133 (GRCm39) missense probably benign 0.29
R1686:Cux1 UTSW 5 136,304,235 (GRCm39) nonsense probably null
R1687:Cux1 UTSW 5 136,341,523 (GRCm39) missense probably damaging 1.00
R1758:Cux1 UTSW 5 136,421,176 (GRCm39) missense probably damaging 1.00
R1797:Cux1 UTSW 5 136,304,169 (GRCm39) missense probably benign 0.22
R1919:Cux1 UTSW 5 136,392,173 (GRCm39) nonsense probably null
R2051:Cux1 UTSW 5 136,361,512 (GRCm39) missense probably damaging 1.00
R2339:Cux1 UTSW 5 136,315,862 (GRCm39) missense probably damaging 1.00
R3438:Cux1 UTSW 5 136,340,414 (GRCm39) missense probably damaging 0.97
R3713:Cux1 UTSW 5 136,594,397 (GRCm39) intron probably benign
R3800:Cux1 UTSW 5 136,344,887 (GRCm39) missense probably damaging 1.00
R3964:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R4135:Cux1 UTSW 5 136,336,750 (GRCm39) missense probably damaging 1.00
R4198:Cux1 UTSW 5 136,315,702 (GRCm39) missense probably damaging 1.00
R4467:Cux1 UTSW 5 136,341,576 (GRCm39) missense probably damaging 1.00
R4498:Cux1 UTSW 5 136,341,847 (GRCm39) missense probably damaging 1.00
R4622:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4623:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4651:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4652:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4658:Cux1 UTSW 5 136,279,448 (GRCm39) missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136,315,653 (GRCm39) missense probably damaging 1.00
R4704:Cux1 UTSW 5 136,278,055 (GRCm39) missense probably benign 0.01
R4867:Cux1 UTSW 5 136,303,815 (GRCm39) intron probably benign
R4965:Cux1 UTSW 5 136,340,410 (GRCm39) missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136,342,054 (GRCm39) missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136,594,295 (GRCm39) intron probably benign
R5226:Cux1 UTSW 5 136,399,027 (GRCm39) missense probably benign 0.01
R5252:Cux1 UTSW 5 136,337,151 (GRCm39) missense probably damaging 0.98
R5266:Cux1 UTSW 5 136,341,548 (GRCm39) missense probably damaging 1.00
R5399:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136,304,171 (GRCm39) missense probably benign 0.13
R5609:Cux1 UTSW 5 136,421,174 (GRCm39) missense probably damaging 1.00
R5681:Cux1 UTSW 5 136,337,038 (GRCm39) missense probably damaging 1.00
R5993:Cux1 UTSW 5 136,392,125 (GRCm39) missense probably benign 0.00
R6049:Cux1 UTSW 5 136,361,564 (GRCm39) missense probably damaging 1.00
R6290:Cux1 UTSW 5 136,340,412 (GRCm39) missense probably damaging 0.99
R6310:Cux1 UTSW 5 136,304,018 (GRCm39) missense probably benign 0.10
R6351:Cux1 UTSW 5 136,338,646 (GRCm39) missense probably damaging 1.00
R6531:Cux1 UTSW 5 136,303,973 (GRCm39) missense probably benign 0.03
R6590:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6663:Cux1 UTSW 5 136,514,701 (GRCm39) missense probably damaging 1.00
R6690:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6777:Cux1 UTSW 5 136,594,422 (GRCm39) intron probably benign
R6786:Cux1 UTSW 5 136,596,085 (GRCm39) missense probably damaging 1.00
R6817:Cux1 UTSW 5 136,402,027 (GRCm39) splice site probably null
R6989:Cux1 UTSW 5 136,308,502 (GRCm39) nonsense probably null
R7011:Cux1 UTSW 5 136,388,887 (GRCm39) missense probably damaging 1.00
R7167:Cux1 UTSW 5 136,338,895 (GRCm39) splice site probably null
R7699:Cux1 UTSW 5 136,514,593 (GRCm39) critical splice donor site probably null
R7861:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136,392,161 (GRCm39) missense probably benign 0.00
R7916:Cux1 UTSW 5 136,311,815 (GRCm39) missense probably damaging 1.00
R8023:Cux1 UTSW 5 136,402,251 (GRCm39) missense probably damaging 0.99
R8154:Cux1 UTSW 5 136,281,434 (GRCm39) missense probably damaging 1.00
R8267:Cux1 UTSW 5 136,311,853 (GRCm39) missense probably damaging 1.00
R8289:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8305:Cux1 UTSW 5 136,388,863 (GRCm39) missense probably benign 0.02
R8319:Cux1 UTSW 5 136,594,251 (GRCm39) missense probably benign 0.02
R8405:Cux1 UTSW 5 136,304,241 (GRCm39) missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136,303,944 (GRCm39) missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8671:Cux1 UTSW 5 136,279,454 (GRCm39) missense probably damaging 1.00
R8680:Cux1 UTSW 5 136,336,710 (GRCm39) missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R8738:Cux1 UTSW 5 136,402,220 (GRCm39) missense probably damaging 1.00
R8793:Cux1 UTSW 5 136,594,539 (GRCm39) missense unknown
R8897:Cux1 UTSW 5 136,315,623 (GRCm39) missense probably damaging 1.00
R8926:Cux1 UTSW 5 136,338,404 (GRCm39) intron probably benign
R8954:Cux1 UTSW 5 136,402,203 (GRCm39) nonsense probably null
R9092:Cux1 UTSW 5 136,514,671 (GRCm39) missense probably damaging 1.00
R9550:Cux1 UTSW 5 136,340,387 (GRCm39) missense probably damaging 0.99
R9578:Cux1 UTSW 5 136,282,919 (GRCm39) critical splice donor site probably null
R9682:Cux1 UTSW 5 136,337,116 (GRCm39) missense probably benign
R9701:Cux1 UTSW 5 136,343,169 (GRCm39) missense probably damaging 0.97
R9712:Cux1 UTSW 5 136,338,673 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGGACGGTATTGACAGTTGCTC -3'
(R):5'- ACGAAAGCATGGTTCACCC -3'

Sequencing Primer
(F):5'- ACAGTTGCTCTACGCTGAG -3'
(R):5'- TGGTTCACCCAGCTACAAGG -3'
Posted On 2022-02-07