Mutagenetix > Incidental Mutation

Incidental Mutation 'R9205:Trpm1'

698444

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 64240571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 974 (V974G)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: V974G

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: V974G

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: V858G

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: V974G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Meta Mutation Damage Score

0.5476

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.3%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	T	A	6: 140,642,228	H341Q	probably damaging	Het
Apob	G	A	12: 7,980,635	A125T	probably damaging	Het
Bace2	G	T	16: 97,356,859	A20S	unknown	Het
Bcar1	T	C	8: 111,715,709	Y238C	probably damaging	Het
Brinp3	A	T	1: 146,902,089	D758V	possibly damaging	Het
Btnl10	T	C	11: 58,920,519	S223P	probably damaging	Het
Cckar	C	T	5: 53,707,245		probably null	Het
Cdhr2	A	G	13: 54,713,988	N66S	probably benign	Het
Chd9	A	G	8: 91,030,642	M1890V	probably benign	Het
Col6a5	C	T	9: 105,878,638	G2196R	probably damaging	Het
Col9a1	T	G	1: 24,185,094	M119R	unknown	Het
Cryaa	A	G	17: 31,679,668	H123R	probably damaging	Het
Cux1	A	T	5: 136,370,135	D171E	probably damaging	Het
Dgkz	T	A	2: 91,933,799	T1067S	probably benign	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dnah5	T	C	15: 28,448,334	M4181T	possibly damaging	Het
Dnajb14	A	G	3: 137,908,384	E352G	possibly damaging	Het
Dnmt3l	T	A	10: 78,056,752		probably null	Het
Dph6	T	C	2: 114,569,514	I117V	probably damaging	Het
Dsg1a	A	G	18: 20,340,171	D767G	probably damaging	Het
Edn3	C	T	2: 174,761,689	P77S	possibly damaging	Het
Elmsan1	A	C	12: 84,152,887	F1020V	probably benign	Het
Fbln7	A	C	2: 128,895,248	S328R	probably null	Het
Fbn2	T	C	18: 58,059,356	R1518G	probably damaging	Het
Foxi2	A	T	7: 135,411,796	T252S	probably benign	Het
Foxred2	A	G	15: 77,952,006	S384P	probably damaging	Het
Gdpd1	G	A	11: 87,045,183	H174Y	probably benign	Het
Gm10542	A	C	18: 44,204,638	D61A	possibly damaging	Het
Gm10563	TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	4: 155,635,850		probably benign	Het
H2-Ab1	A	G	17: 34,265,007	E114G	probably damaging	Het
Htt	C	T	5: 34,819,023	T723M	probably benign	Het
Igfn1	C	T	1: 135,975,957	V348I	probably damaging	Het
Itpr1	T	A	6: 108,489,849	L2173Q	probably damaging	Het
Lamp5	A	G	2: 136,059,601	Y115C	probably damaging	Het
Lrp1	T	A	10: 127,594,981	K400*	probably null	Het
Man2a2	C	T	7: 80,361,120	V708I	probably benign	Het
Matr3	T	C	18: 35,587,721	S746P	probably benign	Het
Me1	C	T	9: 86,598,794	V353M	probably benign	Het
Nbeal1	T	A	1: 60,278,680	D1925E	probably damaging	Het
Oca2	T	A	7: 56,316,420	F387I	probably damaging	Het
Olfr1163	T	A	2: 88,070,434	H316L	probably benign	Het
Olfr181	T	G	16: 58,926,122	I150L	probably benign	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr212	T	A	6: 116,516,354	N192K	probably benign	Het
Olfr420	T	C	1: 174,158,890	I39T	probably benign	Het
Olfr912	T	A	9: 38,582,077	S267T	probably benign	Het
Opn3	G	T	1: 175,663,089	N335K	probably benign	Het
Osm	A	G	11: 4,238,504	N44D	possibly damaging	Het
Otop2	T	C	11: 115,329,086	Y251H	probably damaging	Het
Pappa	T	C	4: 65,156,375	S389P	possibly damaging	Het
Polr1d	C	T	5: 147,101,258	A19V	probably damaging	Het
Ptchd4	G	A	17: 42,503,385	V726M	probably benign	Het
Pzp	T	A	6: 128,496,663	D731V	probably benign	Het
Rgl2	A	T	17: 33,936,028	I669F	probably damaging	Het
Rpl38	T	C	11: 114,672,288	*71R	probably null	Het
Rufy1	G	A	11: 50,398,474	R514W	probably damaging	Het
Ruvbl2	G	A	7: 45,434,317		probably benign	Het
Scn9a	T	G	2: 66,533,313	I874L	probably damaging	Het
Slc14a2	A	G	18: 78,195,736	S85P	probably benign	Het
Slc17a1	A	G	13: 23,878,811	I287V	probably benign	Het
Slc35f3	T	A	8: 126,389,189	I285N	probably damaging	Het
Slx4	A	G	16: 3,988,063	S542P	possibly damaging	Het
Sox30	A	T	11: 46,017,353	L782F	probably damaging	Het
Sspo	A	G	6: 48,455,872	N894S	probably benign	Het
Syne1	G	A	10: 5,202,013	Q5765*	probably null	Het
Taar7e	T	C	10: 24,038,074	I154T	probably benign	Het
Tars	A	G	15: 11,397,179		probably null	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem198b	A	T	10: 128,803,188	C29S	probably damaging	Het
Tnr	A	C	1: 159,895,047	M1021L	probably benign	Het
Tom1l1	G	A	11: 90,657,818	P309L	probably damaging	Het
Traf4	A	G	11: 78,161,101	S186P	probably benign	Het
Tsga10	T	A	1: 37,841,278		probably benign	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r93	A	T	17: 18,304,019	I92F	probably damaging	Het
Zfp457	A	T	13: 67,293,901	D203E	probably benign	Het
Zfp518b	G	A	5: 38,674,158	S168F	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp777	G	A	6: 48,025,587	T523M	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGATCCTCTCAGCTTACTGC -3'
(R):5'- GTGTTAAGCCAGCTGCAAAG -3'

Sequencing Primer
(F):5'- CTCTTTGGGGTTTACTTGTAGATCC -3'
(R):5'- CCAGCTGCAAAGGAAAGACTG -3'

Posted On

2022-02-07