Incidental Mutation 'R9205:Trpm1'
ID 698444
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9205 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63890319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 974 (V974G)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
AlphaFold Q2TV84
Predicted Effect possibly damaging
Transcript: ENSMUST00000085222
AA Change: V974G

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: V974G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000206263
AA Change: V858G

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: V974G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Meta Mutation Damage Score 0.5476 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 T A 6: 140,587,954 (GRCm39) H341Q probably damaging Het
Apob G A 12: 8,030,635 (GRCm39) A125T probably damaging Het
Bace2 G T 16: 97,158,059 (GRCm39) A20S unknown Het
Bcar1 T C 8: 112,442,341 (GRCm39) Y238C probably damaging Het
Brinp3 A T 1: 146,777,827 (GRCm39) D758V possibly damaging Het
Btnl10 T C 11: 58,811,345 (GRCm39) S223P probably damaging Het
Cckar C T 5: 53,864,587 (GRCm39) probably null Het
Cdhr2 A G 13: 54,861,801 (GRCm39) N66S probably benign Het
Chd9 A G 8: 91,757,270 (GRCm39) M1890V probably benign Het
Col6a5 C T 9: 105,755,837 (GRCm39) G2196R probably damaging Het
Col9a1 T G 1: 24,224,175 (GRCm39) M119R unknown Het
Cryaa A G 17: 31,898,642 (GRCm39) H123R probably damaging Het
Cux1 A T 5: 136,398,989 (GRCm39) D171E probably damaging Het
Dgkz T A 2: 91,764,144 (GRCm39) T1067S probably benign Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dnah5 T C 15: 28,448,480 (GRCm39) M4181T possibly damaging Het
Dnajb14 A G 3: 137,614,145 (GRCm39) E352G possibly damaging Het
Dnmt3l T A 10: 77,892,586 (GRCm39) probably null Het
Dph6 T C 2: 114,399,995 (GRCm39) I117V probably damaging Het
Dsg1a A G 18: 20,473,228 (GRCm39) D767G probably damaging Het
Edn3 C T 2: 174,603,482 (GRCm39) P77S possibly damaging Het
Fbln7 A C 2: 128,737,168 (GRCm39) S328R probably null Het
Fbn2 T C 18: 58,192,428 (GRCm39) R1518G probably damaging Het
Foxi2 A T 7: 135,013,525 (GRCm39) T252S probably benign Het
Foxred2 A G 15: 77,836,206 (GRCm39) S384P probably damaging Het
Gdpd1 G A 11: 86,936,009 (GRCm39) H174Y probably benign Het
Gm10542 A C 18: 44,337,705 (GRCm39) D61A possibly damaging Het
Gm10563 TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC 4: 155,720,307 (GRCm39) probably benign Het
H2-Ab1 A G 17: 34,483,981 (GRCm39) E114G probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Igfn1 C T 1: 135,903,695 (GRCm39) V348I probably damaging Het
Itpr1 T A 6: 108,466,810 (GRCm39) L2173Q probably damaging Het
Lamp5 A G 2: 135,901,521 (GRCm39) Y115C probably damaging Het
Lrp1 T A 10: 127,430,850 (GRCm39) K400* probably null Het
Man2a2 C T 7: 80,010,868 (GRCm39) V708I probably benign Het
Matr3 T C 18: 35,720,774 (GRCm39) S746P probably benign Het
Me1 C T 9: 86,480,847 (GRCm39) V353M probably benign Het
Mideas A C 12: 84,199,661 (GRCm39) F1020V probably benign Het
Nbeal1 T A 1: 60,317,839 (GRCm39) D1925E probably damaging Het
Oca2 T A 7: 55,966,168 (GRCm39) F387I probably damaging Het
Opn3 G T 1: 175,490,655 (GRCm39) N335K probably benign Het
Or5d36 T A 2: 87,900,778 (GRCm39) H316L probably benign Het
Or5k17 T G 16: 58,746,485 (GRCm39) I150L probably benign Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or6d12 T A 6: 116,493,315 (GRCm39) N192K probably benign Het
Or6k2 T C 1: 173,986,456 (GRCm39) I39T probably benign Het
Or8b48 T A 9: 38,493,373 (GRCm39) S267T probably benign Het
Osm A G 11: 4,188,504 (GRCm39) N44D possibly damaging Het
Otop2 T C 11: 115,219,912 (GRCm39) Y251H probably damaging Het
Pappa T C 4: 65,074,612 (GRCm39) S389P possibly damaging Het
Polr1d C T 5: 147,038,068 (GRCm39) A19V probably damaging Het
Ptchd4 G A 17: 42,814,276 (GRCm39) V726M probably benign Het
Pzp T A 6: 128,473,626 (GRCm39) D731V probably benign Het
Rgl2 A T 17: 34,155,002 (GRCm39) I669F probably damaging Het
Rpl38 T C 11: 114,563,114 (GRCm39) *71R probably null Het
Rufy1 G A 11: 50,289,301 (GRCm39) R514W probably damaging Het
Ruvbl2 G A 7: 45,083,741 (GRCm39) probably benign Het
Scn9a T G 2: 66,363,657 (GRCm39) I874L probably damaging Het
Slc14a2 A G 18: 78,238,951 (GRCm39) S85P probably benign Het
Slc17a1 A G 13: 24,062,794 (GRCm39) I287V probably benign Het
Slc35f3 T A 8: 127,115,928 (GRCm39) I285N probably damaging Het
Slx4 A G 16: 3,805,927 (GRCm39) S542P possibly damaging Het
Sox30 A T 11: 45,908,180 (GRCm39) L782F probably damaging Het
Sspo A G 6: 48,432,806 (GRCm39) N894S probably benign Het
Syne1 G A 10: 5,152,013 (GRCm39) Q5765* probably null Het
Taar7e T C 10: 23,913,972 (GRCm39) I154T probably benign Het
Tars1 A G 15: 11,397,265 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem198b A T 10: 128,639,057 (GRCm39) C29S probably damaging Het
Tnr A C 1: 159,722,617 (GRCm39) M1021L probably benign Het
Tom1l1 G A 11: 90,548,644 (GRCm39) P309L probably damaging Het
Traf4 A G 11: 78,051,927 (GRCm39) S186P probably benign Het
Tsga10 T A 1: 37,880,359 (GRCm39) probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r93 A T 17: 18,524,281 (GRCm39) I92F probably damaging Het
Zfp457 A T 13: 67,441,965 (GRCm39) D203E probably benign Het
Zfp518b G A 5: 38,831,501 (GRCm39) S168F probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp777 G A 6: 48,002,521 (GRCm39) T523M probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGGATCCTCTCAGCTTACTGC -3'
(R):5'- GTGTTAAGCCAGCTGCAAAG -3'

Sequencing Primer
(F):5'- CTCTTTGGGGTTTACTTGTAGATCC -3'
(R):5'- CCAGCTGCAAAGGAAAGACTG -3'
Posted On 2022-02-07